viernes, 13 de diciembre de 2019

¿Es lícito dejar morir a un ser humano?

¿Es lícito dejar morir a un ser humano por no poder pagar un tratamiento? La congresista norteamericana, Ocasio-Cortez, lo ha dicho bien claro. Se puede hacer negocio de bienes prescindibles, pero no con la vida
Muchas órdenes religiosas tienen como origen el cuidado de los enfermos. Nacieron como organizaciones altruistas. Hoy en día, se pueden ver muchos hospitales privados regidos por congregaciones religiosas. Estos hospitales se rigen por los mismos principios que cualquier empresa: maximización de beneficios. ¿Puede la salud ser un negocio? por supuesto. Lo que calza mal es intentar conjugar lucro y altruismo. ¿Podemos dejar morir a un ser humano por no pagar su tratamiento? esto, obviamente es más discutible

martes, 10 de diciembre de 2019

Streptococcus grupo A utiliza la estrategia de Ulises frente a Polifemo

Unirse a los glóbulos rojos para que no te vean los blancos

David J. González e investigadores de la Universidad de California en San Diego (Estados Unidos) han encontrado que el estreptococo del grupo A (GAS) produce una proteína previamente no caracterizada, llamada proteína S. Esta proteína le permite a la bacteria unirse a la membrana de los glóbulos rojos y de esa manera evitar ser reconocidos por los macrófagos.
En resumen, cuando GAS tiene la proteína S se esconde entre los azúcares de los glóbulos rojos porque la proteína S le permite anclarse de manera específica a los glóbulos rojos. Los glóbulos blancos no se meten a rebuscar entre los azúcares de los glóbulos rojos porque saben que son amigos, pertenecen al mismo cuerpo humano. Si en el laboratorio eliminamos el gen que da lugar a la proteína S, entonces el mutante no se puede unir a los glóbulos rojos y es eliminado por los blancos.
Los griegos ya intuyeron esta estrategia en la manera que en la Iliada, Ulises, escapa de Polifemo, diciéndole a sus hombres que salgan de la cueva debajo de las ovejas del monstruo que tenía, de necesidad, que salir diariamente.

Para saber más

lunes, 18 de noviembre de 2019

Guerra bacteriana: Pseudomonas aeruginosa vs Staphylococcus aureus

Un nuevo estudio realizado por investigadores de la Universidad de Iowa sugiere que P. aeruginosa detecta moléculas secretadas por S. aureus y responde moviéndose rápidamente hacia S. aureus utilizando pequeños apéndices llamados pili para arrastrarse por la superficie. ✔Cuando los P. aeruginosa alcanzan las colonias de S. aureus , los invaden y los destruyen. Es importante destacar que los investigadores mostraron que P. aeruginosa es capaz de montar esta respuesta agresiva a una variedad de diferentes especies y cepas bacterianas recuperadas de una variedad de fuentes, incluidos los pacientes con fibrosis quística, lo que sugiere que esta puede ser una táctica universal utilizada por P. aeruginosa para competir contra otras especies bacterianas.
Las estrategias de aprovechamiento que las bacterias usan para competir entre sí pueden conducir a nuevas terapias antimicrobianas. Para saber más

viernes, 15 de noviembre de 2019

Un protozoo con capacidad para diseñar redes de comunicación

Un grupo de investigadores japoneses realizó un estudio con el protozoo Physarum polycephalum, un tipo de ameba, en donde se comprobó que construyeron una red de túbulos que conectaba fuentes de alimento de manera muy cercana a la red ferroviaria de Tokio. El experimento aprovechó la habilidad para producir túbulos que unen las colonias del moho con sus fuentes de alimento. Para ello, se utilizó una placa traslúcida que reproducía la posición central de Tokio y las ciudades satélite poniendo granos de avena simulando su distribución en el territorio. El resultado de la ameba (también llamado hongo mucilaginoso, aunque no pertenece al reino de los hongos) es muy similar a la red de ferrocarril de Tokio, una red que se ha construído a lo largo de muchos años y que el hongo es capaz de reproducir en pocas horas.

Referencias
Atsushi Tero, Seiji Takagi, Tetsu Saigusa, Kentaro Ito, Dan P. Bebber, Mark D. Fricker, Kenji Yumiki, Ryo Kobayashi, Toshiyuki Nakagaki. [www.sciencemag.org/cgi/content/abstract/327/5964/439 Rules for Biologically Inspired Adaptive Network Design]. Science, Vol. 327, No. 5964. (22 de enero de 2010), pp. 439-442.


martes, 12 de noviembre de 2019

Tutorial sobre epigenética

Tutorial sobre epigenética, para saber más pincha aquí

Genomic DNA is modified by chemical markers, which can change gene expression without altering the underlying genetic code. These so-called epigenetic tags (described in the videos) can also mark DNA to distinguish old strands from those that are freshly made, or can be used by the cell to identify foreign DNA. One of these epigenetic modifications is the addition of a methyl group to the DNA molecule; this methylation process is carried out by enzymes called methyltransferases. Different methyltransferase enzymes create different methyl tag patterns, and now scientists reporting in Nature Communications have learned more about linking methyltransferases to their methylation scheme.


If researchers attempt to introduce foreign DNA into an organism, such as when the genes required for manufacturing some important chemical are introduced into bacteria that are supposed to start making that chemical. Often, a host will reject this foreign DNA. The methylation patterns on the DNA molecule indicate that it's not native, and the host cell will destroy it. Bacteria that are commonly used in the lab, like E. coli, can usually withstand the introduction of foreign DNA and won't chop it up, but many other microbes will, impeding research.
Este video explica el proceso de metilación del ADN y su importancia en la transcripción eucariot usando metilasas de ADN y metilasas de histonas. Para más información: http://shomusbiology.weebly.com/ Para descargar material: http://shomusbiology.weebly.com/bio-m... Fuente: Dr. Anindita Banerjee, Department of Microbiology, St. Xavier's college

"Knowing which enzyme does what opens up to a lot of applications. With this knowledge, you can construct model organisms with artificial methylomes, mimicking the methylation pattern of the strain you want to introduce DNA to. In this way you can ensure [the] survival of introduced DNA," said the first author of the study, Specialist Torbjørn Ølshøj Jensen of The Novo Nordisk Foundation Center for Biosustainability (DTU Biosustain) at the Technical University of Denmark (TUM).

"Working in other bacteria than E. coli, you often have to do a lot of trial and error when it comes to DNA transformation, but that's just not good enough. You need knowledge and tools. With this, you have a systematic and rational way of fixing the problems," explained Jensen.

Working towards that goal, the researchers aimed to find what enzyme was creating which methylation pattern. They created circular strands of DNA (plasmids) that carried a methyltransferase gene. These were coupled with multiple copies of a specific DNA sequence, which were intended to be targets for the methyltransferase enzymes encoded by the plasmid. The team repeated this study for every methyltransferase.


The researchers could then observe the specific impact of individual methyltransferases by detecting the methyl groups on the target DNA sequences.

The scientists confirmed their results by assessing the genomes of two microbes used in manufacturing. Together, they carry 23 genes for methyltransferases, with twelve methylation patterns on their DNA. This suggested that not all their methyltrasnferases were at work, so the scientists looked for active methyltransferase genes in the bacterial genomes. After investigating the methylation patterns, they traced eleven of the twelve back to specific genes. This work can help create clearly defined 'methylomes' that describe methylation patterns in hosts, and make adding foreign DNA to these hosts easier
https://www.labroots.com/trending/genetics-and-genomics/15462/revealing-epigenetic-patterns-specific-enzymes-create?fbclid=IwAR3v3I-DwlyTDWX6rcx-C4Lxs-kcBjGVOGdvR8mwTVaIC6BkYCPmUxHQHU8

lunes, 11 de noviembre de 2019

¿Qué es la hipótesis del mundo ARN?

Me ha encantado esa comparación de que la célula en el fondo es la casa que protege y sostiene el mundo ARN.
Código genético y la relación clonal entre los distinto códones. Fuente
. Fuente

PREGUNTA: Tenemos un ORF:  ATGTATGGATACGCCTCTTCGGAGGGCAACTTAGAATAA
y a partir de esta secuencia tenemos una descendencia en la que se pueden observar tres mutantes:
Mutante 1:
ATGAATGGATACGCCTCTTCGGAGGGCAACTAGAATAA
Mutante 2:
ATGTACGGGTACGCATCGTCGGAGGGAAATTAGAATAA
Mutante 3:
ATGATATGGATACGCCTCTTCGGAGGGCAACTAGAATAA

¿Cuál de los mutantes tendrá más mutaciones? ¿Cuál de los mutantes será el que tenga menos? ¿Cómo afectarán esas mutaciones a la proteína resultante? Para ello traduce cada triplete utilizando la tabla 

SOLUCIÓN:
ORF: ATG TAT GGA TAC GCC TCT TCG GAG GGC AAC TAG AAT AA

1      ATG AAT GGA TAC GCC TCT TCG GAG GGC AAC TAG AAT AA

2      ATG TAC GGG TAC GCA TCG TCG GAG GGA AAT TAG AAT AA

3      ATG ATA TGG ATA CGC CTC TTC GGA GGG CAA CTA GAA TAA

PREGUNTA: Cuando no existían bacterias toda la vida sobre la Tierra era vírica. Eran protovirus de ARN que tenían ribosomas. Estos virus se replicaban en la sopa biológica (en Ecuador en el locro biológico). Cuando aparecieron las bacterias, éstas tenían una membrana que diferenciaba fuera de dentro. Las bacterias metieron dentro todo lo que les interesaba de la sopa biológica. Los protovirus al quedarse sin su alimento sufrieron una presión selectiva que favoreció a aquellos virus que sabían como penetrar en el interior de las bacterias y alimentarse de lo que antaño había sido suyo. Nacieron los virus como entidades parásitas de las células. Muchos biólogos siguen diciendo, de forma equivocada, que los virus no son entidades vivas porque se tienen que alimentar de una célula metabólicamente activa. Si es por eso, podríamos incluir en la categoría de virus a muchas personas que no son capaces de subsistir sin su tarjeta de crédito. ¿Cómo perdieron los protovirus sus ribosomas? porque hoy en día los virus actuales no tienen ribosomas. Como siempre la solución está en la selección natural. Imaginemos dos virus A y B. El virus A es un protovirus, tiene ribosomas, y su ARN tiene 60.000 bases. El virus B perdió los genes de los ribosomas y por esa razón tienen 40.000 bases. No necesita codificar ribosomas porque puede utilizar los de la bacteria que infecta. Ambos virus infectan y se replican en el interior de bacterias. Si la ARN polimerasa copia a una velocidad de 1000 bases por minuto y los cromosomas de A y B tienen un solo Ori. ¿Cuánto tiempo tarda cada virus en replicarse? ¿Cuánta descendencia tendrá cada virus al cabo de seis horas?

SOLUCIÓN: Virus A 30 minutos virus B 20 minutos. En seis horas tendremos de A  4096 virus, y de B tendremos 262144 virus. Si en vez de horas hablásemos de miles de años podemos entender porqué los virus actuales carecen de ribosomas.

PREGUNTA: ¿Qué fue antes el huevo o la gallina? ¿Qué proceso ocurrió antes en la evolución, el paso de ADN a ARN o el paso de ARN a proteínas? 

sábado, 9 de noviembre de 2019

Veintidós niños huérfanos coruñeses llevaron la vacuna por todo el mundo

El descubrimiento de la vacuna por Edward Jenner se publica en el año 1800. En 1803 sale de A Coruña una goleta con 22 niños huérfanos. A uno de esos niños se le ha inoculado el virus de la viruela de vaca, que protege a los humanos de la mortal viruela humana. Cuando a este niño le salen unas pequeñas pústulas, la única manifestación del virus de la vaca, los médicos pinchan la pústula y se la inoculan a otro niño. De esa manera, la Expedición Balmís, lleva el virus de la vaca, la vacuna, viva desde A Coruña a América. En Quito, la población se vacunó de manera masiva en 1805. Todavía no hay en la ciudad de Quito una calle, o un monumento que mencione esta gesta.
Fuente
Para saber más, pinchad aquí. Se trata de un artículo excelente de Laura Garofano publicado en el Mundo.



viernes, 8 de noviembre de 2019

Si soy capaz de transmitirme seré un parásito exitoso

El que vive a expensas de otros debe transmitirse una vez que ha agotado a su presa. La transmisión es una de las características de los patógenos. Pueden transmitirse por el agua, por el aire, o a través de animales hematófagos (se alimentan de sangre). Son los vectores, organismos vivos que pueden transmitir enfermedades infecciosas entre personas, o de animales a personas:

Las seis estructuras chupadoras de un mosquito buscando un capilar sanguíneo
Mosquitos. Los mosquitos han cambiado la historia de la humanidad, especialmente los géneros Aedes, Anopheles y Culex
Flebótomos, su picadura es el medio de transmisión de la leishmaniasis, de la bartonelosis y de algunas infecciones por arbovirus.
Las garrapatas transmiten encefalitis; enfermedad de Lyme; fiebre hemorrágica de Crimea-Congo; fiebre recurrente (borreliosis); ricketsiosis (fiebre maculosa y fiebre Q) y tularemia. Fuente
Triatominos: enfermedad de Chagas (tripanosomiasis americana). Fuente
Mosca tsetsé: enfermedad del sueño (tripanosomiasis africana). Fuente
Pulgas: peste (transmitidas por pulgas de las ratas al ser humano) y rickettsiosis. Fuente
Moscas negras: oncocercosis (ceguera de los ríos). Fuente
Caracoles acuáticos: esquistosomiasis (bilharziasis). Fuente
Piojos: tifus y fiebre recurrente transmitida por piojos. Fuente

miércoles, 6 de noviembre de 2019

¿Por qué los holandeses son tan altos?

PROBLEMA: Los holandeses en 1860 eran, como colectivo, de los más bajos de Europa. Ello era debido a que tenían una dieta pobre, basada en las papas y el maiz, y bebían agua contaminada. Holanda, como país, tiene gran parte de su territorio por debajo del nivel del mar. Gracias a unos diques, los polders, evitan que el mar inunde estas áreas. Por ese motivo, la capa freática se encuentra muy superficial. Como siempre ha tenido una cabaña ganadera muy importante, especialmente vacas, acordaros de sus famosos quesos, el agua en el siglo XIX se encontraba contaminada. Cuando variaron su dieta y empezaron a purificar el agua la altura de los holandeses pasó de 1.64 cm de media a 1.84 cm ¡Un aumento de 20 cm! SOLUCIÓN: una dieta variada y sobre todo, beber agua potable, hizo que aumentasen de tamaño



John Snow establece una relación epidemiológica entre el agua contaminada de heces y los brotes de cólera
En 1854 John Snow demuestra que el agua contaminada es el agente propagador de la cólera en Londres. En la fotografía, una de las bombas que se empleaban en el S XIX para proporcionar agua a la población
John Snow hizo un rastreo de las familias que presentaban casos de cólera y se dió cuenta que todas vivían alrededor de algunas bombas de agua. Curiosamente todas esas bombas pertenecían a la red de una empresa de suministro de aguas que tomaba el agua del Támesis, pero en vez de tomarla río arriba, tomaba el agua río abajo, cuando ya había sido contaminado con las heces de los habitantes de esta ciudad, muchos de ellos con cólera, con lo que se establecía un ciclo de contaminación fecal-oral.
John Snow, padre de la epidemiología moderna, cartografía los brotes de cólera y descubre que todos están asociados con bombas de agua contaminada con heces. En esa época no estaba claro el origen de las enfermedades infecciosas y muchos pensaban que las enfermedades las producían emanaciones de sitios pantanosos.
Fuente
En este gráfico se puede ver la evolución de las muertes causadas por agentes infecciosos por cada 100.000 habitantes en los USA durante el siglo XX. Alrededor de 1910 se implementó la cloración del agua en las ciudades de los EEUU. Se puede ver el impacto de esta medida en la drástica reducción de muertes por enfermedades infecciosas.

La higiene corta la transmisión fecal-oral

Eugenio Espejo, Ignacio Semmelweis, Joseph Lister... fueron pioneros en introducir la idea de que para parar las infecciones había que impedir la transmisión del agente causante de la infección. La vía de contaminación fecal-oral es la más habitual. Es decir, la que va desde las heces de personas o de mamíferos a la boca de otros seres humanos.
En el Ecuador se pueden observar filtros de piedra volcánica en casas y museos. El filtro funciona como un cedazo que impide que la bacteria o el parásito atraviese el filtro con lo que se interrumpe la vía de transmisión.

En Quito, la actual calle Guayaquil, se llamaba churretas, porque era una escorrentía de las churretas de porquería de la ciudad hacia la quebrada 24 de mayo. En tiempos de Eugenio Espejo, la ciudad de Quito, carecía de alcantarillado. De manera muy sagaz, el Dr. Espejo, intuyó que las personas contraían enfermedades de solo caminar por esas calles inmundas.
Filtro volcánico de piedra. Museo Casa del General Sucre en Quito
En Ecuador, se pueden observar filtros de piedra volcánica en la Casa del General Sucre en Quito. La existencia de estos filtros hablan de una comunidad preocupada por la limpieza y pureza del agua. Si tenemos en cuenta que el General Sucre compra su casa en 1828 y que en 1854 John Snow demuestra que el agua contaminada es el agente propagador de la cólera en Londres y que en 1860 es cuando Luis Pasteur establece la teoría microbiana de la enfermedad, estamos hablando de unas gentes que ya se preocupaban de la higiene.
Para saber más:
https://www.huffpost.com/entry/why-are-the-dutch-so-tall_b_5544085

miércoles, 23 de octubre de 2019

Si los problemas generan valor deben ser mantenidos

Un amigo psicólogo lee la noticia: La resistencia a antibióticos se duplicará en 20 años, y se acordó de mi. Las noticias de calamidades no cuentan que uno de los factores de este problema es que, en nuestro sistema económico, las calamidades generan beneficio, y por tanto convienen. El escritor Phillip K. Dick ya intuyó en una de sus obras esta paradoja.

En el Decámeron, Bocaccio, ya hablaba de la imposibilidad de escapar de la peste en 1353. Pandemias víricas, bacterias resistentes a los antibióticos, pérdidas de ganado por enfermedades contagiosas... son problemas que deben tratarse de manera multidisciplinar. Pero quizás haya quien con estos problemas esté ganando dinero. Si es así, estas personas y estos intereses deberían ser considerados también parte del problema.  
De los cuatro Jinetes de la Apocalisis, el cuarto representa a la peste, es decir, las pandemias capaces de segar las vidas de una tercera parte de la población. Las enfermedades infecciosas siempre han estado en el imaginario humano
El concepto One Health es una estrategia para aumentar la comunicación y la colaboración interdisciplinar en el cuidado de la salud de las personas, los animales y el medio ambiente, a nivel mundial, entendiendo que todas están ligadas entre sí. Surge la Iniciativa One Health de la mano de dos médicos, Laura H. Kahn y Thomas P. Monath, y un veterinario, Bruce Kaplan, en 2006. Esta iniciativa ha ido incluyendo posteriormente a más investigadores del ámbito de la salud, médicos y veterinarios expertos en salud pública a nivel mundial. Quizás habría que incluir también a economistas si el problema es también un problema de intereses económicos.
La producción industrial de carne es para los microorganismos un nicho ecológico fantástico en donde transmitirse sin problema

Donde hay escasez hay beneficio
El escritor de ciencia ficción, Phillip K. Dick, ha sido llevado a las pantallas en al menos 12 de sus obras. El mérito de este autor no es literario porque escribe bastante mal, de forma deslavazada, sin demasiado cuidado. Sin embargo, de repente, es capaz de crear páginas icónicas como el famoso: "Yo he visto cosas que ustedes no creerían. Naves de ataque en llamas..." en donde se plasma la adquisición del alma por un replicante, un producto de la ingeniería genética.

En su novela Podemos recordarlo todo para usted que originó la película "Total recall" describe como, en Marte, las autoridades conocen la existencia de una máquina de origen extraterrestre capaz de generar oxígeno suficiente para crear una atmósfera como la de la Tierra. Sin embargo, las autoridades mantienen esa fábrica cerrada y en secreto porque la mejor manera de mantener a los habitantes humanos de Marte controlados es con el suministro limitado de oxígeno. Phillip K. Dick nos muestra, con la inquebrantable fe del visionario, que el capitalismo no busca solucionar problemas, sino que los problemas, si generan valor, son bienvenidos.
Venky: familias felices comiendo pollo y bacterias resistentes a la colistina, un antibiótico utilizado contra las bacterias multirresistentes. O te mueres de hambre o te mueres de una bacteria multirresistente ¿Debemos elegir entre esta alternativa?
La estrategia one health no logrará éxito si no se tiene este factor en cuenta. En este blog ya hablamos de la empresa india Venky. Una empresa que es la mayor productora de carne de pollo en la India y que a su vez es también productora de antibióticos, algunos de ellos como la colistina, la última barrera antibiótica frente a ciertas bacterias resistentes. ¿De qué sirve investigar cepas bacterianas con resistencia a la colistina si se puede comprar este antibiótico por kg en internet? Si se usa un antibiótico de manera masiva se van a seleccionar bacterias mutantes con modificaciones en los fosfatos del lípido A y por tanto indiferentes a la acción letal de este producto. Esto hará que algún otro antibiótico suba su precio. El problema ha sido originado por la avaricia de un productor sin escrúpulos. La aparición de bacterias mutantes hará que este nuevo antibiótico se vuelva ineficaz y de nuevo habrá que migrar hacia otro. La situación es la óptica para un sistema que siempre busca excluir a la competencia. Es una realidad que parece ideal para el comportamiento del sistema económico en el que nos encontramos

viernes, 11 de octubre de 2019

Como limpiarse bien el culo

Es muy importante, sobre todo para las chicas,  limpiarlo de adelante hacia atrás. Hacerlo en sentido contrario es uno de los principales factores de riesgo de infecciones de orina.
 La flora intestina aerobia, los llamados coliformes, como Escherichia coli, Klebsiella, Enterobacter, son los principales productores de infecciones del tracto urinario, siendo E. coli responsable del 80% de estas infecciones.

viernes, 27 de septiembre de 2019

Cistitis recurrentes en ancianos y bacterias sin pared celular


Existen dos grandes tipos de bacterias, las más antiguas, las arqueobacterias, que viven en sitios extremos como aguas termales. Estas bacterias son los primeros seres vivos con membrana plasmática que existieron en el planeta Tierra. Por eso todavía viven en aquellos lugares que asemejan a como era el planeta hace 4000 millones de años. El otro gran grupo es el de las eubacterias, o bacterias verdaderas, es decir, aquellas que causan problemas a los humanos. Como somos tan antropocéntricos las llamamos verdaderas :)
Las eubacterias, a diferencia de las arqueobacterias, están rodeadas de una malla de peptidoglicano. Esta malla les proporciona una protección porque su interior tiene presión, como los neumáticos. La función de esta malla es evitar que la presión interna celular haga explotar.

Las bacterias cuando se dividen tienen que ir aflojando la malla para poder crecer y al mismo tiempo tienen que crear más malla y anudarla para evitar que la presión interna les haga explotar. Los antibióticos tipo penicilina impiden que se anude la nueva malla. Esto hace que la presión interna haga explotar a la bacteria. Así es como funcionan estos antibióticos.
A la izquierda, bacterias creciendo en presencia de penicilina. A la derecha bacterias creciendo sin penicilina ¿Se ve la diferencia?

Lo normal es que todas las eubacterias tengan esa pared celular formada principalmente por la malla de péptidoglicano, pero como siempre en biología, existen eubacterias que por ciertas circunstancias pueden carecer de la pared celular de peptidoglicano, son las llamadas formas L porque se descubrieron en el Instituto Lister de Londres.
¿Qué es una forma L? son bacterias sin pared celular. Algunas bacterias Gram negativas pueden convertirse a Formas L en medios con osmolaridad normal o fisiológica.

Investigadores del Hospital Newcastle Freeman encontraron cepas de E. coli, Enterococcus, Enterobacter y Staphylococcus en cistitis de pacientes ancianos con infecciones recurrentes.

A continuación, las cultivaron en el laboratorio y procedieron a grabar en video cómo se comportaban frente a antibióticos que atacan la pared celular como las penicilinas y derivados. Se podía ver como en presencia del antibiótico las bacterias carecían de pared celular y que solo cinco horas después de haber sido obtenidas del paciente comenzaban de nuevo a fabricar una pared celular.
Infectaron con estas bacterias peces transparentes, los famosos peces cebra, y observaron el mismo fenómeno. De esa manera, comprobaron que lo que se había observado in vitro también ocurría in vivo. En la fotografía laboratorio de cría de peces cebra

Las formas L son muy delicadas. Las bacterias en forma L no podrían sobrevivir en personas sanas ya que las defensas de su organismo atacarían a estas bacterias más vulnerables. Sin embargo, en ancianos o individuos inmunodeprimidos la reacción defensiva no sería suficiente para acabar con todas. Por eso, bajo las conclusiones del estudio, es importante utilizar nuevas estrategias en este tipo de pacientes. Por ejemplo, utilizar un tratamiento formado por dos fármacos, un antibiótico dirigido a la pared celular, que estimularía que pasaran a forma en L, y otro que terminara de fulminar a los microbios debilitados que quedaran después.

También es importante tener en cuenta este hallazgo de cara al diagnóstico, pues han descubierto que las bacterias en forma de L estallan y desaparecen por el efecto del gel empleado en las técnicas de diagnóstico empleadas normalmente en el hospital, de modo que se formarían falsos negativos.

Referencia:
https://www.nature.com/articles/s41467-019-12359-3

martes, 3 de septiembre de 2019

Sanatorio para sifilíticos

Este cartel, impreso por J. Thomas, en Barcelona, en el año 1900, fue realizado por el pintor catalán Ramón Casas i Carbó por encargo del Sanatorio para sifilíticos del doctor Abreu, sito en el número 74 de la calle Mayor de la Bonanova, de esa misma ciudad. Una clínica dedicada al tratamiento de la sífilis, en una época en que todavía no se conocía la arsfenamina (un compuesto de arsénico), el medicamento descubierto por Paul Ehrlich, que vino a revolucionar el tratamiento de la enfermedad desde que fue comercializado, en 1910. Este artista precursor del cartelismo artístico en Cataluña, como dicen Vigué y Ricketts, "...resolvió el encargo con singular maestría, sirviéndose de elementos tan expresivos como sutiles." Y añaden:

"El cartel está dividido en tres partes. Consta de un título en la zona superior, una imagen de una mujer en el centro y una leyenda en la zona inferior, donde se ofrecen los datos de la clínica que se publicita ('curación absoluta y radical en el Sanatorio para sifilíticos...').
La S de sífilis [todas las "s", en realidad, que aparecen en el cartel] recuerda la forma de una serpiente que alude a la peligrosidad de la enfermedad, que acecha venenosa desde los rincones más oscuros. No hay que olvidar que en la Barcelona de aquella época se transmitía sobre todo por el contacto con las prostitutas que trabajaban cerca del puerto. En el centro aparece una mujer con mantón de Manila, similar a las atractivas 'chulas' de los carteles de la época, como la del Anís del Mono (realizado por el mismo Casas). Sin embargo, se diferencia de ellas en que no aparece tan hermosa, sino pálida y desmejorada, con la maraña de pelo despeinado y la delgadez anémica apenas cubierta. Es un fiel retrato de la enfermedad, que consume a quien la sufre. Sostiene en su mano un lirio blanco, que simboliza la esperanza de la curación. El árido panorama de esta mujer enferma, verdadera personificación de la enfermedad, se completa con un fondo neutro de color anaranjado que potencia la sensación de palidez demacrada y debilidad de la protagonista."

lunes, 5 de agosto de 2019

Estructuras ocultas en la evolución de un patógeno

These Maps Reveal the Hidden Structures of 'Choose Your Own Adventure' Books
"Hidden structures" ¿Cuáles son esas estructuras ocultas? todo un caramelo para un genetista y para un experto en grafos.

Estos árboles-mapa representan las distintas rutas que pueden tomar unos libros de aventuras interactivos. ¿Por qué en un blog de bacteriología? bien, los microorganismos siguen un patrón de especiación semejante.

Si aparece una mutación, o la adquisición por vía horizontal de un gen, o un grupo de genes, la nueva bacteria se irá diferenciando en un nuevo grupo ya que las nuevas características le proporcionarán mejores aptitudes a la hora de dejar progenie en nuevos nichos ecológicos. Hasta aquí algo que sabemos todos.

Lo interesante de esta manera de analizar el cómo se desarrolla una trama de aventuras para adolescentes es que puede servir para entender cómo una bacteria medioambiental se puede volver un patógeno. Por ejemplo, a partir de una Escherichia coli intestinal pueden aparecer 6 o más patotipos, es decir, E. coli con capacidad de ser patógena para el que antiguamente era su hospedador. La pregunta es: ¿Te vuelves delincuente cuando alguien te da una pistola? o ¿Te empiezas a volver un delincuente cuando te sientes un marginado? Muchas veces estudiamos E. coli viendo a día de hoy que genes de virulencia tiene para comportarse como un patógeno. ¿En qué orden se fueron adquiriendo esos genes? Para responder esta pregunta la línea de tiempo importa, lo mismo que para convertirte en un delincuente hay siempre unos primeros pasos. Esos pasos tienen siempre que ver con la pertenencia al grupo. Posiblemente en el caso de las bacterias sean estructuras víricas, como transposones, plásmidos, que tengan mecanismos de toxina antitoxina. En todo caso es una hipótesis que habría que comprobar.

Es muy curioso observar que cuando una bacteria ambiental comienza a volverse patógena existe cierta reducción de su genoma. Es como si las habilidades para ser delincuente le bastasen y tener genes de más, habilidades de más, sobrasen en este nuevo de estilo de vida criminal.
Para ser un ladrón exitoso no necesitamos saber mucho, eso si, lo que hacemos lo tenemos que hacer bien y en la secuencia correcta. Tenemos que asustar a la víctima para que haga lo que queramos; tenemos que ser expeditivos si la víctima no hace lo que queremos; tenemos que tener con que escapar; tenemos que tener una chaqueta reversible para evitar que nos reconozcan...

domingo, 4 de agosto de 2019

Convierten sangre tipos A, B y AB en sangre universal

RBC "red blood cell" glóbulo rojo. Antígenos A, B y H. Las flechas muestran los puntos de ruptura de la α-N-acetyl-galactosaminidase o la α-galactosidase durante la conversión del antígeno H.
Este estudio pasó bastante desapercibido, pero soluciona uno de los mayores problemas que nos encontramos en clínica: la escasez de distintos tipos de sangre. Gracias al estudio de la microbiota intestinal los investigadores encontraron enzimas que podrían eliminar los azúcares que conforman los antígenos A y B de la sangre. De esta manera se podría tratar sangres tipo A, B o AB para convertirlas en sangres universales tipo 0.


Artículo original aquí

jueves, 25 de julio de 2019

¿Miedo a la brucelosis o el derecho al autoconsumo?

En las inmediaciones de la iglesia de la Magdalena, en el sur de Quito, en domingo, observé la venta de leche directamente de la cabra. En 2011, un estudio realizado por Gabriel Trueba, la la USFQ, demostró la presencia de brucelosis en la leche de cabra que se vende en Quito.

Es algo que se puede regular con controles periódicos. Sin embargo, quiero dar mi opinión sobre esta práctica. Creo que el estado no debe prohibir la venta callejera. Es el derecho de todos los individuos, poder trabajar. Digo esto porque en España se ha prohibido la venta callejara, y desde los poderes públicos se desincentiva el que una persona sea autosuficiente. Por ejemplo, esta noticia que reproduzco parcialmente:

"La Junta de Andalucía, en España, determinó este lunes que en diez días, el jubilado Guillermo Cana deberá sacrificar (sus 9 ovejas) en un máximo de 10 días.

El argumento de esta decisión según la Junta se basa en que se trata de una explotación clandestina y acusa al propietario de los animales de usarlos para autoconsumo, de acuerdo con Europa Sur.

Guillermo recibió a principios del pasado junio la visita de una inspección veterinaria de la Dirección Provincial de la Agencia de Gestión Agraria de Andalucía.

Como el anciano no tiene un certificado veterinario que indique que los animales que cuida desde pequeñitos -cuatro ovejas, tres chivos, una cabra y un carnero- están en perfecto estado, los inspectores le comunicaron que se le sancionó por una falta grave, por supuestamente tener una explotación de animales sin identificación".

Los niños de Turín no podrán llevar comida de casa al colegio
La higiene como excusa para fomentar la comida industrial. Si, como lo leéis. Noticia aquí. Dice el juez que “posible violación de los principios de igualdad y de no discriminación, en base a las condiciones económicas, así como del derecho a la salud, teniendo en cuenta los riesgos higiénicos y sanitarios de un almuerzo individual y no controlado”.

lunes, 22 de julio de 2019

Los peligros de la industrialización

La producción de carne barata industrial ha permitido que mucha gente pueda comer carne. Para abaratarla se ha tenido que concentrar y estabular el ganado. Para evitar la dispersión de enfermedades se les administra antibióticos en el pienso. El resultado es la aparición de bacterias resistentes. La producción de carne barata industrial ha acabado con muchas granjas familiares.

Generar miedo ¿Aumenta los beneficios?
En el libro de Phillip K. Dick "Podemos recordarlo por usted al por mayor" que dio lugar a la película "Total recall", el autor nos muestra como los procesos industriales no buscan satisfacer la demanda de un producto. Buscan que ese producto tenga un valor de mercado. En la novela, los habitantes del planeta Marte tienen que pagar por su oxígeno. A veces hay escasez de oxígeno, con lo que su valor se mantiene o aumenta. Paradójicamente en el planeta existe una poderosa planta generadora de oxígeno levantada por una civilización extraterrestre. Los poderes públicos mantienen la planta cerrada bajo secreto porque intuyen que controlar el acceso al oxígeno es una manera efectiva de tener a la población bajo control.

Nos quieren consumidores, no productores, ni autosuficientes
No puede haber desarrollo sostenible si desde el estado se ataca a la pequeña producción, al establecimiento de unidades familiares. Es un ataque en toda regla. Hoy salió esta noticia: la Junta de Andalucía le da 10 días a un pastor jubiliado, o sea pobre, para que sacrifique a cuatro ovejas, tres chivos, una cabra y un carnero. Los animales se llaman Cariñosa, Guapa, Niña, Vieja, Topacio, Carnero y los tres Solitarios. En España tenemos las macrogranjas industriales más grandes de Europa. Lo que contamina el 40% de los acuíferos del país. Pero, obviamente, ese no es el problema. Tienen certificado veterinario. Da igual que los animales estén en jaulas minúsculas, estresados y cebados con antibióticos para evitar la dispersión de enfermedades. El problema son los 9 animales de un pastor jubilado.En este video, Nel Cañedo, conocido pastor de los Picos de Europa, en Asturias, España denuncia de forma irónica la clausura de un gallinero cercano a un hotel rural en Asturias porque los gallos molestaban a los huéspedes. Su análisis es impecable: la culpa es del juez. Y tiene toda la razón.
 
Las leyes y los poderes públicos no pueden condenar que una persona pueda ser autosuficiente, tener unas ovejas, o unas gallinas en un pueblo. El desarrollo sostenible empieza por permitirle a la gente solucionar sus problemas. Necesitamos menos legislación* y que el estado deje de regular los asuntos propios de las personas. El estado está para condenar a quienes hagan las cosas mal, no para decir que es lo que tienes que hacer. Hay una diferencia. Tienen suficiente trabajo con las multinacionales que ganan millones y no pagan impuestos gracias a la ingeniería financiera. Es un sistema fuerte con los débiles y débil con los fuertes, que además favorece que las personas sean consumidoras y no productoras.

* Las legislaciones extensas hacen que los únicos que puedan pedir un certificado de agrocalidad sean empresas grandes con abogados y expertos trabajando a tiempo completo para conseguir esos certificados. Si tu eres un pequeño productor, el esfuerzo por cubrir todas las especificaciones que se piden en la ley no te compensa, por ejemplo, conseguir el certificado para tu pequeña producción de pienso para hamsters.

La industralización de la ciencia ha generado precariedad y miedo entre los científicos
Jerome R. Ravetz es un matemático y filósofo de la ciencia norteamericano es uno de los fundadores de la llamada ciencia post-normal. En 1971 publica un libro muy influyente: «Scientific knowledge and its social problems» con el que pretende refundir los aspectos sociales y éticos de la investigación científica con la filosofía de la ciencia y reflexionar sobre las limitaciones de la emergente, en ese momento, «ciencia industrializada»:

Raventz sugiere que para lograr resultados científicos valiosos se necesitan tres factores separados: 1 una comunidad de académicos con un conocimiento compartido de los estándares de calidad apropiados para su trabajo 2 un compromiso común por hacer cumplir esos estándares mediante las sanciones informales que la comunidad posee y 3 personas cuya integridad personal exija estándares por lo menos tan altos como los requeridos por la comunidad de pares.

Esta estructura artesanal y gremial, si se quiere, ha sido sustituida por el reinado de los gestores académicos, por el "publish or perish". La permanencia de un científico en una institución depende del número de artículos que sea capaz de producir y del número de proyectos que tenga, independientemente del valor o de la originalidad de la investigación que esté realizando. Esto lleva a la desmoralización de muchos científicos, e incluso al suicidio.


Se ha generado una industria de la publicación científica. El perfil de científico exitoso es aquel que es capaz de mantener un alto nivel de producción. La tentación de "relajar" los estándares de calidad, o de simplemente plagiar una y otra vez el mismo resultado forma parte de este juego de producir. Grandes científicos están siendo salpicados por este tipo de escándalos. Lo mismo que en la película Matrix, estamos frente a la disyuntiva de escoger la píldora azul o la roja.

https://www.elsaltodiario.com/universidad/papers-y-mas-papers-las-sombras-en-la-industria-de-las-publicaciones-cientificas

https://www.elsaltodiario.com/paradoja-jevons-ciencia-poder/corrupcion-en-la-investigacion-cientifica-un-problema-estructural

https://www.madrimasd.org/blogs/salud_publica/2009/05/24/118784

http://www.nogracias.eu/2019/04/11/la-necesidad-de-una-ciencia-critica-la-crisis-cochrane-profetizada-hace-50-anos-por-jerome-ravetz-por-abel-novoa/

https://www.theguardian.com/commentisfree/2009/apr/27/swine-flu-mexico-health

jueves, 18 de julio de 2019

Foro: tecnología para el desarrollo sostenible

La vida surge allá donde existían fuentes de agua limpia. Con el aumento de la población humana aumentan los microorganismos patógenos en estas fuentes ¿Podemos evitar esta contaminación? por supuesto: cloración, filtración, ozonificación. Sistemas costosos que funcionan bien en poblaciones urbanas, pero ¿Qué ocurre con la población rural dispersa? ¿Con los refugiados de guerrras o de catástrofes ambientales? Los filtros cerámicos son una solución barata y eficaz para estos problemas. Una tecnología del neolítico que solo necesita la cocción de barro en horno de leña para solucionar un problema del siglo XXI
El agua no potable es más mortífera que todas las guerras del mundo.  La falta de agua potable es consecuencia de la pobreza. La diarrea mata más niños en el mundo al año (1.5 millones) que por SIDA, paludismo y sarampión juntos. Uno de los mayores responsables es el rotavirus para el que existe vacuna
Filtro colonial de piedra volcánica. Museo de Manta. En esta ciudad, Ernesto Rojas purifica agua con el uso de filtros coloniales, tiene dos en su propiedad que está ubicada cerca de la Universidad Laica Eloy Alfaro de Manabí (Uleam). Fuente
 Fernando Mazariegos (Guatemala, 1938) desarrolló los ecofiltros de barro en 1980 capaces de filtrar 80 litros de agua por día
Ron Rivera (EEUU 1948-2008) fundó la ONG “Potters for Peace” para desarrollar fábricas de filtros baratos en todo el mundo
Una manera de conseguir agua potable durante dos años por un coste de 30$ son los filtros de barro. En nuestro programa de radio explicamos como y también entrevistamos al Pastor Ramiro Baez, impulsor de la fábrica de filtros Horeb en el Ecuador:
Los filtros de barro tienen dos cuerpos: el filtro y el recipiente. Los precios van de 25 euros si el recipiente es de plástico y 100 si el recipiente es también de barro
El recipiente de barro se hace a partir de proporción de barro y cascarilla de arroz (23% peso seco), o viruta de pino. El barro se debe de filtrar para evitar impurezas. En Ecuador, un país volcánico es importante asegurarse que el barro empleado no tenga trazas de arsénico.

El uso de la prensa hidráulica garantiza un grosor homogeneo del filtro
Se comprueba que filtran entre 1 y 2 litros por hora. Se añade nitrato de plata como solución bactericida
Las piezas se prensan, se pulen y se dejan secar antes de cocer a 966ºC (se incinera la materia orgánica)
 Los artesanos comprobaron que se vendían mejor los filtros con recipiente de barro que no los de plástico que recordaban a la ayuda al desarrollo
El autor del blog (vestido de manera un poco peliculera) con su amiga Carmen Morales de Chacapata
Se filtró 100 ml de agua de vertientes (C y F), así como del río Machángara (D) o agua de Quito (A). El agua de la vertiente C se filtró y el resultado (B) es tan bueno como el agua de Quito. El agua de la vertiente (F) se filtró pero el resultado es mejorable (E), esto se debe a que la casa en la que estaba este filtro instalado, el agua del filtro estaba estancada y había animales que entraban en la cocina
Se tradujo al kichwa un folleto de 16 páginas para explicar cómo nos enfermamos al beber agua no potable y cómo se usan los filtros cerámicos
Virus, bacterias y parásitos entran en uno de los 10 kits que se desarrollaron en esta iniciativa
Gracias a estos kits se puede tocar y visualizar los distintos tamaños y de como el filtro funciona como un cedazo para eliminarlos del agua filtrada
De nuestro trabajo hemos observado que los filtros son muy eficaces para evitar la dispersión de bacterias multirresistente a antibióticos
Trajimos al ceramista catalán Josep Matès mediante una campaña de crowdfunding.
Josep Matès aprovechó su estancia en Pifo, Ecuador, no solo para construir un horno de cerámica negra sino también para impartir talleres de cerámica a los más pequeños
Atención al minuto 7

La ONG Potters for Peace se hizo eco en su boletín de nuestra campaña de crowfunding para recaudar dinero para construir un horno de cerámica negra
Carmen Morales vive mejor que trabajadores de Amazon, Disney y Facebook (y además es generosa, simpática y vive rodeada de sus vecinos y amigos)
Y antes de finalizar, quisiera recordar a Carmen Morales, de Chacapata. Carmen ya tiene agua potable gracias a estos filtros. La calidad de vida de Carmen es infinitamente mejor que la de mucha gente en países desarrollados. Carmen vive rodeada de vecinos, en una comunidad estructurada. Con acceso a sanidad. Tiene huerta, animales domésticos. Las dos veces que estuve con ella nunca me fui de su casa con las manos vacías. Las fotografías que se ven abajo son de las personas que viven en tiendas de campaña en Ann Arbor, Michigan. 2000 personas en una ciudad de 100.000 habitantes viven en carpas incluso en los 3-4 meses de invierno con nieve. Y no solo Ann Arbor, Los Ángeles, también en España, en Ibiza, los trabajadores no pueden costearse un alquiler. Trabajar en empresas como Disney o Facebook no te garantiza llegar a fin de mes. Por eso, mucha gente ya no consume fruta fresca y en pleno siglo XXI ya han aparecido casos de escorbuto. Eso no pasa en Chacapata.
Nos quieren consumidores, no productores, ni autosuficientes
No puede haber desarrollo sostenible si desde el estado se ataca a la pequeña producción, al establecimiento de unidades familiares. Es un ataque en toda regla. Hoy salió esta noticia: la Junta de Andalucía le da 10 días a un pastor jubiliado, o sea pobre, para que sacrifique a cuatro ovejas, tres chivos, una cabra y un carnero. Los animales se llaman Cariñosa, Guapa, Niña, Vieja, Topacio, Carnero y los tres Solitarios. En España tenemos las macrogranjas industriales más grandes de Europa. Lo que contamina el 40% de los acuíferos del país. Pero, obviamente, ese no es el problema. Tienen certificado veterinario. Da igual que los animales estén en jaulas minúsculas, estresados y cebados con antibióticos para evitar la dispersión de enfermedades. El problema son los 9 animales de un pastor jubilado.
En este video, Nel Cañedo, conocido pastor de los Picos de Europa, en Asturias, España denuncia de forma irónica la clausura de un gallinero cercano a un hotel rural en Asturias porque los gallos molestaban a los huéspedes. Su análisis es impecable: la culpa es del juez. Y tiene toda la razón.

Las leyes y los poderes públicos no pueden condenar que una persona pueda ser autosuficiente, tener unas ovejas, o unas gallinas en un pueblo. El desarrollo sostenible empieza por permitirle a la gente solucionar sus problemas. Necesitamos menos legislación* y que el estado deje de regular los asuntos propios de las personas. El estado está para condenar a quienes hagan las cosas mal, no para decir que es lo que tienes que hacer. Hay una diferencia. Tienen suficiente trabajo con las multinacionales que ganan millones y no pagan impuestos gracias a la ingeniería financiera. Es un sistema fuerte con los débiles y débil con los fuertes, que además favorece que las personas sean consumidoras y no productoras.

* Las legislaciones extensas hacen que los únicos que puedan pedir un certificado de agrocalidad sean empresas grandes con abogados y expertos trabajando a tiempo completo para conseguir esos certificados. Si tu eres un pequeño productor, el esfuerzo por cubrir todas las especificaciones que se piden en la ley no te compensa, por ejemplo, conseguir el certificado para tu pequeña producción de pienso para hamsters.

Para saber más:
http://bacteriasactuaciencia.blogspot.com/2018/09/proyecto-de-vinculacion-con-la.html 
http://bacteriasactuaciencia.blogspot.com/2016/03/fabrica-horeb-de-filtros-de-barro-para.html