martes, 31 de diciembre de 2019

Los antibióticos solo matan bacterias. No matan virus

Los antibióticos, como por ejemplo la penicilina, sirven solo para matar bacterias. Nunca matan células eucariotas como las células humanas.  Esto es así porque la penicilina inhibe la síntesis de peptidoglicano. El peptidoglicano es una malla que está presente en las bacterias. Las células humanas carecen de esta malla. ¿Por qué es importante la malla de peptidoglicano en las bacterias? porque las bacterias tienen una presión interna muy alta. Las células humanas no, por eso carecen de esta malla. Si las bacterias no tuviesen esta malla explotarían. Cuando las bacterias crecen en presencia de penicilina, que inhibe la formación de nueva malla, las bacterias explotan. 
 En el video se observan dos cultivos de Escherichia coli. A la izquierda se encuentran E. coli creciendo en presencia de penicilina, a la derecha E. coli crece sin la presencia de antibiótico. Se puede observar cómo al crecer en presencia de penicilina las bacterias literalmente explotan.
A la izquierda un virus humano: el adenovirus. A la derecha un virus de bacterias, el bacteriófago, o más coloquialmente fago
 Existen dos grandes tipos de virus: los virus que invaden y se replican dentro de bacterias, llamados fagos, y los que se invaden y se replican en las células eucariotas como las células humanas. La diferencia entre los dos tipos de virus es que los virus de bacterias tienen que tener un sistema que bombea los ácidos nucleicos en el interior de la bacteria. Esta bomba está acoplada a unas especies de patas como las que utilizan los mosquitos para posarse en la piel que van a chupar. El mecanismo es similar. Los mosquitos chupan y los fagos inyectan. Los virus humanos entraran en la célula mediante una invaginación de la membrana. Por lo tanto, cuando se tiene una enfermedad humana producida por un virus es completamente inútil darle a un paciente un antibiótico. No va a tener ningún efecto sobre la enfermedad vírica porque los virus no pueden ser atacados por los antibióticos.

domingo, 29 de diciembre de 2019

Práctica laboratorio: obtención de penicilina


ADVERTENCIA: LA PENICILINA OBTENIDA EN ESTA PRÁCTICA NO ES DE USO HUMANO. SOLO PARA SU USO EN LABORATORIO

Las penicilinas son producidas por muchos hongos, particularmente especies de Penicillium y Aspergillus. La fabricación de penicilina es un ejemplo del proceso típico de obtención de antibióticos.
El hongo utilizado industrialmente pertenece al grupo del Penicillium chrysogenum.
Objetivos

  • Obtención de penicilina por inoculación de esporas de Penicillium chrysogenum previamente sembradas en agar sabouraud-glucosa en medio de cultivo líquidoque contiene los nutrientes apropiados para la generación y crecimiento de la biomasa.
  • Comprobar el efecto del antibiótico sobre la cepa Escherichia coli, por el método de los discos de difusión

Materiales y Métodos

Material

Microorganismo: cultivo de Penicillium chrysogenum, obtenido de una naranja
enmohecida y sembrada en agar Sabouraud-glucosa: glucosa: 40.0g, peptona: 10.0g, agar: 15.0g, agua destilada: 1L (pH 5.6).

Material de uso común en el laboratorio: 1 jeringa desechable de 5 ml, agua estéril para inyección, algodón, gasa, asa de siembra, papel indicador del pH (1-7), embudo de vidrio con filtro redondo, mechero Bunsen, erlenmeyer de 500ml.

Método 
Preparación del inóculo: Se debe repicar Penicillium chrysogenum en un tubo de ensayo que contenga agar sabouraud inclinado y dejarlo crecer durante 8 días, mientras este tiempo transcurre se disuelven los componentes del caldo de cultivo (lactosa: 30.0g, glucosa: 10.0g, extracto de levadura: 40.0g, nitrato sódico: 3.0g, dihidrogenofosfato sódico: 0.5g, fenilacetato sódico: 0.3g, sulfato magnésico: 0.25g, sulfato de cinc: una punta de espátula, agua corriente: 1L) en un erlenmeyer de 500ml, se ajusta a pH entre 5.5 y 6, se tapa con algodón y se esteriliza en autoclave a 121°C por 15 minutos. Al día siguiente se procede a la siembra, para ello, se debe limpiar la cabina correctamente, y llevar allí, el medio autoclavado, guantes quirúrgicos, asa de siembra, jeringa desechable de 5 ml, agua estéril para inyección, aspersor con alcohol, gasa y mechero; encender el motor de la cabina y la lámpara germicida y dejar durante 20 minutos, luego apagar la lámpara germicida , encender la lámpara fluorescente, incluir el inóculo y proceder con la inoculación de la siguiente manera: Saque 5ml de agua para inyección con la jeringa y descárguelos sobre el tubo donde se encuentra el inóculo, agite un poco con cuidado de no regar nada y luego adicionar en el erlenmeyer donde se encuentra el medio, realice el mismo procedimiento con 5 ml más y tape con el algodón. Saque todo el material de la cabina, limpie bien con alcohol y gasa, lleve el medio al agitador orbital (shaker) controle el pH cada 2 ó 3 días manteniéndolo a pH 5, durante 10 a 15 días.

Cristalización de la penicilina: Filtrar el caldo de cultivo; tomar el filtrado y ajustar el pH a 2.0 con ácido fosfórico, añadir un volumen igual de éter enfriado en un baño de hielo; luego adicionar unas puntas de espátula de sulfato sódico anhidro, concentrar a vacío hasta reducir a 1/4 el filtrado, añadir un poco de solución de éter disuelto en trietilamina. Filtrar y recoger los cristales obtenidos.

Cortar con perforadora pequeños círculos de papel de filtro e impregnarlos con el filtrado del medio, luego colocarlos en una caja de petri, la cual previamente ha sido sembrada con un microorganismo sensible a la penicilina, que puede ser: Escherichia coli y Pseudomonas fluorescens. Incubar a 28ºC por 24 horas; al día siguiente se comprueba la actividad de la penicilina por la aparición de halos de inhibición alrededor de los discos de papel.

Preparación de las placas de ensayo


Microorganismo: Escherichia coli.
Material: Agar de ensayo para bacterias: agar MacConkey.
Aparatos: Asas de siembra y mechero Bunsen, espátula de Drigalski, pipetas desechables (1ml estériles), solución de NaCl (0,9%, estéril), tubos de ensayo (estériles)

Procedimiento operativo: Suspender un asa de siembra de las bacterias de ensayo en 2ml de solución de cloruro sódico estéril; pasar 0,1ml de la suspensión bacteriana a la placa con agar de MacConkey; extenderla regularmente con la espátula de Drigalski, secar las placas: dejarlas a 45ºC en una incubadora o estufa abierta, durante 20 minutos. Colocar la tapa, tener listas las placas de ensayo, durante 2 horas.

Comprobación de la penicilina con un ensayo de difusión

Material: Placas de ensayo, discos de papel impregnados de penicilina
Aparatos: Pinzas, mechero Bunsen, estufa y regla graduada
Procedimiento operativo:Colocar los discos de papel con penicilina sobre las placas de ensayo con las pinzas esterilizadas a la llama (3-5 discos), incubar las placas de ensayo a 28ºC, durante 24 horas

Controlar las placas: se comprueba la actividad de la penicilina por la aparición de halos de inhibición alrededor de los discos de papel.

Resultado:El diámetro del halo de inhibición es una medida de la acción (y concentración) antibiótica de la penicilina obtenida. Los halos claros se miden con la regla y los datos obtenidos se reúnen en una tabla. Si se tiene poca práctica, aunque la manipulación haya sido cuidadosa pueden producirse errores, por lo que es recomendable llevar a cabo cada experiencia por triplicado. Por ello, habría que realizar la preparación para la cristalización de la sal de penicilina sólo cuando se haya establecido con certeza la actividad antibiótica con el ensayo con el filtrado de cultivo.

viernes, 27 de diciembre de 2019

Ruminococcus: aumenta con las mascotas y disminuye con los cuñados

El impacto que tienen el contacto con los cuñados en la microbiota intestinal durante las comidas y cenas de Navidad fue publicado este verano en el Human Microbiome Journal. El microbiólogo Ignacio López-Goñi ha escrito esta entrada en su blog: Cómo los cuñados afectan a tu flora intestinal. 

La conclusión del estudio es que las personas que había visitado a sus cuñados tenían una disminución significativa de todas las especies de Ruminococcus, género bacteriano que se sabe que está asociado a estrés psicológico y depresión.
Hoy las ciencias adelantan. que es una barbaridad. ¡Es una brutalidad! ¡Es una bestialidad!. Fuente: La verbena de la Paloma

Una investigación realizada por la Universidad de Alberta ha revelado que la presencia de animales en casa, especialmente perros, puede ayudar a prevenir las alergias y la obesidad en lo más pequeños. Los investigadores descubrieron que niños sanos que habían crecido en ambientes con mascotas, mostraban una mayor presencia en su flora intestinal de dos bacterias benignas, la Ruminococcus y la Oscillospira, que están vinculadas con un menor riesgo de sufrir alergias y sobrepeso.

Investigadores de Taiwan analizaron la microbiota antes y después de la aparición de la alergia (los estudios anteriores habían estudiado principalmente a sujetos ya enfermos) y evitaron los sesgos genéticos y ambientales utilizando una cohorte de treinta gemelos, desde el nacimiento hasta los 3 años de edad. Analizaron muestras de heces de estos niños desde el nacimiento hasta la edad de un año para caracterizar su microbiota. Para validar sus resultados, desarrollaron en paralelo un modelo de asma experimental (en ratones) que sometieron a la infección por Ruminococcus gnavus para asegurarse de que la bacteria inducía el desarrollo de la alergia y estudiar sus mecanismos fisiopatológicos. Los resultados demuestran que R. gnavus, une bacteria anaerobia grampositiva del orden de los Clostridiales, es responsable de la aparición de episodios alérgicos (asma o rinitis) en la población de niños analizada, resultado corroborado en el modelo animal. Según los resultados del estudio, esta sobreabundancia de R. gnavus provoca una inflamación del tracto intestinal, que a su vez genera un aumento del número de linfocitos y eosinófilos que pasan a la circulación sanguínea y linfática y causan una reacción alérgica en las vías respiratorias.

Por lo tanto, no nos queda claro el papel de Ruminococcus en nuestra salud. Solo podemos decir que aumenta con las mascotas y disminuye con los cuñados... y tu ¿A quién quieres más ?

https://www.sciencedirect.com/science/article/pii/S2452231719300090#s0080

https://microbiomejournal.biomedcentral.com/articles/10.1186/s40168-017-0254-x

Chua HH et al. Intestinal Dysbiosis Featuring Abundance of Ruminococcus gnavus Associates With Allergic Diseases in Infants. Gastroenterology 2017 sept. 11. https://www.ncbi.nlm.nih.gov/pubmed/28912020

Microbiomas maduros a base de garbanzos, plátano, soja y harina de cacahuete

Suplementar la leche en polvo y el arroz que se daba hasta ahora a los niños desnutridos con garbanzos, plátano, soja y harina de cacahuete ayuda a que maduren sus microbiomas correctamente. Fuente

Cada año millones de niños que sufren hambrunas son incapaces de recobrarse del hambre completamente. Después de 10 años de investigación se ha descubierto el porqué: los niños desnutridos tienen una microbiota inmadura, como la de un recién nacido. Se han encontrado 15 tipos de bacterias que son los que hay que tener para tener un microbioma maduro. Ahora ya somos capaces para responder a la siguiente pregunta: ¿Qué alimentos hay que darles para que restauren su flora intestinal? La ayuda alimenticia que se les daba a los niños desnutrido consistía en arroz y leche en polvo, lo cual no ayudaba mucho a que se expandieran las poblaciones de esas 15 bacterias esenciales. Ahora bien, cuando se le añaden garbanzos, plátano, soja y harina de cacahuete los microbiomas maduran y los niños se recobran completamente

References
E. Pennisi, Gut microbes may help malnourished childrenScience, Vol. 365, p. 109, 12 July 2019

Cómo se generan las simbiosis: lecciones de Prometheoarchaeum


La bacteria pulpoPrometheoarchaeum syntrophicum
. Fuente
Prometheoarchaeum syntrophicum strain MK-D1 es una arqueobacteria del grupo Asgard. Un grupo de científicos japoneses, después de 12 años de intentarlo, han conseguido aislarla de los sedimentos marinos y cultivarla en laboratorio, lo cual abre las puertas a la experimentación científica. ¿Por qué es tan interesante esta bacteria? porque crece mejor si está en asociación con otras bacterias. Además, forma tentáculos con los que puede atrapar a las bacterias que se volverán sus compañeras, formando así relaciones simbióticas con ellas.

Si tenemos un modelo bacteriano de simbiosis podremos empezar a hacerles preguntas. Es una pena porque ya han existido modelos semejantes, por ejemplo el de las amebas y la bacteria X del científico surcoreano Jeon. En este modelo se puede observar cómo las bacterias X y las amebas acaban formando una simbiosis perfecta, en donde las bacterias necesitan a la ameba pero la ameba no puede vivir sin ellas. En este blog ya le dediqué una entrada.

Bacterias que nos enseñan que la teoría endosimbiótica de Lynn Margulis está en lo cierto existen algunas, como Gemmata obscuriglobus. Esta bacteria es una Gram negativa pero que carece de péptidoglicano. Una especie de eslabón perdido. Sería algo así como el paso de las arqueobacterias a las Gram negativas.

Esta bacteria es muy interesante porque al no tener peptidoglicano no tiene una presión interna elevada y su membrana crea compartimentos similares a los que tiene la célula eucariota. De hecho se cree que las invaginaciones de la membrana plasmática de esta bacteria serían como un preambulo del núcleo celular.
Si bien, las bacterias son generalmente clasificados como procariotas,
es decir, ausentes de membrana nuclear, siempre existen excepciones, como Gemmata obscuriglobus, una bacteria, que presenta compartimentos internos,
como una membrana intracitoplasmática y una membrana nuclear. Fuente: Nature
¿Qué aprenderemos de Prometheoarchaeum?

Hace unos meses me acerqué con mi compañera Hégira Ramírez a la mezquita de Quito (y no, no es un juego de palabras). Me regalaron varios libros, uno de ellos el siguiente:
La primera parte del libro está escrita con bastante rigor, los últimos capítulos el autor se relaja bastante. El argumento principal fue básicamente el que me repitieron los dos imanes (religiosos musulmanes, nada que ver con el magnetismo): la Biblia había sido escrita y traducida por hombres mientras que el Corán era la transcripción literal de las palabras de Dios. De esta manera, se justifica la línea evolutiva en al que primero el Dios de Abraham habla exclusivamente para las tribus judías, posteriormente, su hijo, también Dios para los cristianos, simplemente un profeta, para los musulmanes, expande el compromiso divino a otros pueblos además del hebreo. Allah, hablando por la boca del profeta Mahoma decide acabar con las múltiples interpretaciones del mensaje divino con un texto al que no se le puede cambiar ni una coma. De esa manera, el Corán lleva sin modificaciones más de 1400 años.

Quizás todo esto sea mentira desde un punto de vista factual, es decir, que no hay hechos reales que lo corroboren. Aunque sea factualmente inexacto es socialmente exacto. En el libro de Caraballo se muestra cómo existen en la Biblia algunos pasajes muy contradictorios. Esto originó en el pasado luchas entre los distintos clanes. Hoy en día, el cristianismo sigue dividido en múltiples facciones. Frente a esto se opone la unidad del islam. Obviamente esto no es del todo cierto porque también en el islam hay distintos clanes y facciones.

Podemos ver estudiando la historia de las religiones como hay dos fuerzas contrapuestas: la unidad y el deseo de formar una unidad aparte. Entender este tipo de gramática de cómo se generan los grupos es importante porque está en la base de nuestros conflictos armados. Conocer la verdad es importante, pero también lo es permanecer a una tribu. Si estos dos deseos no entran en conflicto perfecto. Si no lo hacen... las consecuencias son terribles.

Estudiando bacterias como Prometheoarchaeum y como genera simbiosis con otras bacterias nos permitirá aprender el abc, la gramática de cómo nos organizamos en grupos de una manera científica, basada en hechos. Existen otros modelos para entender la lógica de grupos en bacterias, como por ejemplo Myxococcus xantus, pero Promethearchaeum nos muestra cómo se establecen vínculos indisolubles entre bacterias muy distintas entre si. Lo que necesitamos para limar asperezas entre grupos radicales.

Para saber más:

Como siempre, la entrada sobre Prometheoarchaeum del investigador Manuel Sánchez, son mucho más didácticas e interesantes que las mías.

H. Imachi et al., Isolation of an archaeon at the prokaryote-eukaryote interface, bioRxiv, 6 August 2019

E. Pennisi, Tentacled microbe hints at how simple cells became complex, Science, Vol. 365, p. 631, 16 August 2019

https://www.newscientist.com/article/2213037-deep-sea-microbe-could-answer-one-of-evolutions-biggest-mysteries/

jueves, 26 de diciembre de 2019

Virus llevándose la membrana de la célula eucariota

Los protovirus se constituían de ARN, proteínas y ribosomas. Eran de vida libre y se replicaban en medio de la sopa biológica. Cuando aparecieron las primeras arqueobacterias, éstas captaron casi todo el contenido de la sopa al interior de su citoplasma. Cuando aparecieron las bacterias perdieron sus ribosomas, convirtiendose en los virus actuales, capaces sólo de replicarse en el interior de célular.Cuando las arqueobacterias desarrollaron una capa de péptidoglicano que les permitió tener presión, los virus seleccionados tuvieron patitas de mosco y un aparato para inyectar los ácidos nucleicos a presión. Posteriormente surgió por simbiosis la célula eucariota y los virus también estaban allí para replicarse en el interior de las nuevas células. Con el tiempo algunos virus ARN y virus ADN aprendieron a salir de las células eucariotas parte de su membrana que es lo que se puede apreciar en este virus

sábado, 21 de diciembre de 2019

¿Qué he estado haciendo este último año?

En esto he estado metido más o menos el último año:

Docencia

En el último año he impartido la asignatura de biología celular y molecular médica, teoría y práctica para alumnos de medicina de la UDLA. Durante mi trayectoria docente he impartido además microbiología médica, bioquímica médica,  genética e introducción a la investigación.

He realizado en mi actual universidad cursos de Moodle, gameficación en el aula… Este año he realizado videos de las clases impartidas. El objetivo era orientar las clases a un modelo de aula invertida, apoyándome en el formato de lecciones de Moodle.  



En mis clases procuro que los alumnos que tienen peor rendimiento se sienten en las primeras filas. Normalmente hago preguntas sobre la materia de clase a los alumnos que se sientan en las últimas filas. Procuro que se formen grupos de trabajo en las clases. Animo a los alumnos más adelantados a que enseñen a sus compañeros.

Divulgación y vinculación con la comunidad

Actualmente estoy colaborando, junto con otros compañeros de la carrera de Medicina, con la Alcaldía de Quito para elaborar unas guías de higiene en los mercados de la ciudad por encargo de la Coordinación de la facultad de Medicina

http://bacteriasactuaciencia.blogspot.com/2019/06/manipulacion-de-alimentos-en-mercados.html

Recientemente hemos publicado un artículo sobre el contenido de bacterias resistentes a los antibióticos en las heces encontradas en los parques de Quito. La noticia fue cubierta por El Comercio y Redacción Médica. Varias radios de Quito se hicieron eco de la noticia

https://www.sciencedirect.com/science/article/pii/S2213716519300918?via%3Dihub

https://www.elcomercio.com/actualidad/excrementos-mascotas-riesgos-salud-humanos.html

https://www.redaccionmedica.ec/secciones/salud-publica/estudio-demuestra-presencia-de-e-coli-resistente-a-los-antibioticos-en-las-heces-de-perros-94039

Mantengo dos blogs de ciencia, uno de ellos con 1.390.000 visitas

http://bacteriasactuaciencia.blogspot.com/2016/10/aldolasa.html

Colaboro con Esteban Ortiz, docente-investigador de la UDLA, en su programa Frecuencia Médica en la radio pública ecuatoriana

https://www.youtube.com/watch?v=KN6IV6Iif_k

Mantengo una colaboración con la radio pública gallega (España) con una sección propia llamada “Circo de bacterias”

https://www.youtube.com/watch?v=UxY_mKsvmtU

He prologado el libro “Glicocalix. Rol en clínica humana y enfoque translacional. Ed. Cide ISBN: 978 9942 792 37 2

Revisión de un artículo de divulgación científica para la revista TsaFiqui de la UTE de Quito, Ecuador

He realizado videos en mi canal de youtube para utilizarlos en aulas invertidas

https://www.youtube.com/watch?v=OW4_BZAEw-A

Proyectos científicos financiados

Genotipaje de E. coli uropatogénicas resistentes a cefalosporinas de tercera generación en hospitales y carcasas de pollo en Quito. Entidad financiadora UDLA Quito. Código proyecto: MED.EFM.18.08

Bacteriófagos anti Salmonella enterica serovar Infantis y Escherichia coli patogénica extraintestinal multirresistentes de importancia en la industria avícola del Ecuador. Entidad financiadora UDLA Quito. Código proyecto MED.EFM.19.04

Publicaciones en 2019

https://f1000research.com/articles/8-290

https://www.ncbi.nlm.nih.gov/pubmed/30980959

Prevalencia de Escherichia coli resistente a colistina y cefalosporinas de tercera generación aisladas de carcasas y ciegos de pollos Broiler en Quito-Ecuador. ECUADOR ES CALIDAD: I CONGRESO INTERNACIONAL: Revista Científica Ecuatoriana. Resistencia a los antimicrobianos con enfoque one health. Márquez, Andrea 1; Ortega-Paredes, David1; Fernández Moreira, Esteban2; Vinueza Burgos, Christian1.

Charlas

Expositor en el “I Congreso Internacional: Resistencia a los Antimicrobianos con Enfoque One Health” (CINRAM-OH), 20 y el 22 de noviembre, Quito, Ecuador. "Biotecnología de bacteriófagos para control de bacterias patógenas"
Expositor en las II Jornadas Médicas de Actualización e Investigación HQSur
2019Filtros de barro: tecnología neolítica para un problema del siglo XXI

Posters en congresos internacionales

Co-autor en el abstract „Broiler farms and carcasses are an important source for dissemination of ESBL- MCR-1-producing Escherichia coli in Ecuador“ with abstract ID 7775 for the 30th European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) París, Francia. Abril 2020

Posters en congresos nacionales

Prevalencia de Escherichia coli resistente a colistina y cefalosporinas de tercera generación aisladas de carcasas y ciegos de pollos Broiler en Quito-Ecuador. I Congreso Internacional: Resistencia a los Antimicrobianos con Enfoque One Health” (CINRAM-OH), 20 y el 22 de noviembre, Quito, Ecuador.
¿Se puede relacionar a las infecciones del tracto urinario por Escherichia coli BLEE ST131 adquiridas en la comunidad con la industria avícola?. . I Congreso Internacional: Resistencia a los Antimicrobianos con Enfoque One Health” (CINRAM-OH), 20 y el 22 de noviembre, Quito, Ecuador.
Colaboraciones
Realizo una colaboración con Christian Vinueza, director del UNIETAR de la Universidad Central del Ecuador
Colaboro con Francisco Mora, Director de Investigación del Hospital del Sur de Quito
Colaboro con la Dra Zurita en el Hospital Vozandes de Quito
Estudiantes
Codirijo, junto con Christian Vinueza de la U. Central, la tesis doctoral del investigador David Alejando Ortega Paredes, en la Universidad de Santiago de Compostela, España, en el “Programa de Doutoramento en Avances en Bioloxía Microbiana e Parasitaria”

Actualmente tengo una pasante que colabora en mi proyecto de investigación sobre fagos: Camila Guzmán, estudiante de 6 semestre de Biotecnología de la UDLA

La estudiante Lea Schwartkop, estudiante de último año de Medicina hace una tesis de fin de carrera sobre la percepción de conceptos genéticos en alumnos de ciencias de las salud y carrera no afines

viernes, 13 de diciembre de 2019

¿Es lícito dejar morir a un ser humano?

¿Es lícito dejar morir a un ser humano por no poder pagar un tratamiento? La congresista norteamericana, Ocasio-Cortez, lo ha dicho bien claro. Se puede hacer negocio de bienes prescindibles, pero no con la vida
Muchas órdenes religiosas tienen como origen el cuidado de los enfermos. Nacieron como organizaciones altruistas. Hoy en día, se pueden ver muchos hospitales privados regidos por congregaciones religiosas. Estos hospitales se rigen por los mismos principios que cualquier empresa: maximización de beneficios. ¿Puede la salud ser un negocio? por supuesto. Lo que calza mal es intentar conjugar lucro y altruismo. ¿Podemos dejar morir a un ser humano por no pagar su tratamiento? esto, obviamente es más discutible

martes, 10 de diciembre de 2019

Streptococcus grupo A utiliza la estrategia de Ulises frente a Polifemo

Unirse a los glóbulos rojos para que no te vean los blancos

David J. González e investigadores de la Universidad de California en San Diego (Estados Unidos) han encontrado que el estreptococo del grupo A (GAS) produce una proteína previamente no caracterizada, llamada proteína S. Esta proteína le permite a la bacteria unirse a la membrana de los glóbulos rojos y de esa manera evitar ser reconocidos por los macrófagos.
En resumen, cuando GAS tiene la proteína S se esconde entre los azúcares de los glóbulos rojos porque la proteína S le permite anclarse de manera específica a los glóbulos rojos. Los glóbulos blancos no se meten a rebuscar entre los azúcares de los glóbulos rojos porque saben que son amigos, pertenecen al mismo cuerpo humano. Si en el laboratorio eliminamos el gen que da lugar a la proteína S, entonces el mutante no se puede unir a los glóbulos rojos y es eliminado por los blancos.
Los griegos ya intuyeron esta estrategia en la manera que en la Iliada, Ulises, escapa de Polifemo, diciéndole a sus hombres que salgan de la cueva debajo de las ovejas del monstruo que tenía, de necesidad, que salir diariamente.

Para saber más

lunes, 18 de noviembre de 2019

Guerra bacteriana: Pseudomonas aeruginosa vs Staphylococcus aureus

Un nuevo estudio realizado por investigadores de la Universidad de Iowa sugiere que P. aeruginosa detecta moléculas secretadas por S. aureus y responde moviéndose rápidamente hacia S. aureus utilizando pequeños apéndices llamados pili para arrastrarse por la superficie. ✔Cuando los P. aeruginosa alcanzan las colonias de S. aureus , los invaden y los destruyen. Es importante destacar que los investigadores mostraron que P. aeruginosa es capaz de montar esta respuesta agresiva a una variedad de diferentes especies y cepas bacterianas recuperadas de una variedad de fuentes, incluidos los pacientes con fibrosis quística, lo que sugiere que esta puede ser una táctica universal utilizada por P. aeruginosa para competir contra otras especies bacterianas.
Las estrategias de aprovechamiento que las bacterias usan para competir entre sí pueden conducir a nuevas terapias antimicrobianas. Para saber más

viernes, 15 de noviembre de 2019

Un protozoo con capacidad para diseñar redes de comunicación

Un grupo de investigadores japoneses realizó un estudio con el protozoo Physarum polycephalum, un tipo de ameba, en donde se comprobó que construyeron una red de túbulos que conectaba fuentes de alimento de manera muy cercana a la red ferroviaria de Tokio. El experimento aprovechó la habilidad para producir túbulos que unen las colonias del moho con sus fuentes de alimento. Para ello, se utilizó una placa traslúcida que reproducía la posición central de Tokio y las ciudades satélite poniendo granos de avena simulando su distribución en el territorio. El resultado de la ameba (también llamado hongo mucilaginoso, aunque no pertenece al reino de los hongos) es muy similar a la red de ferrocarril de Tokio, una red que se ha construído a lo largo de muchos años y que el hongo es capaz de reproducir en pocas horas.

Referencias
Atsushi Tero, Seiji Takagi, Tetsu Saigusa, Kentaro Ito, Dan P. Bebber, Mark D. Fricker, Kenji Yumiki, Ryo Kobayashi, Toshiyuki Nakagaki. [www.sciencemag.org/cgi/content/abstract/327/5964/439 Rules for Biologically Inspired Adaptive Network Design]. Science, Vol. 327, No. 5964. (22 de enero de 2010), pp. 439-442.


martes, 12 de noviembre de 2019

Tutorial sobre epigenética

Tutorial sobre epigenética, para saber más pincha aquí

Genomic DNA is modified by chemical markers, which can change gene expression without altering the underlying genetic code. These so-called epigenetic tags (described in the videos) can also mark DNA to distinguish old strands from those that are freshly made, or can be used by the cell to identify foreign DNA. One of these epigenetic modifications is the addition of a methyl group to the DNA molecule; this methylation process is carried out by enzymes called methyltransferases. Different methyltransferase enzymes create different methyl tag patterns, and now scientists reporting in Nature Communications have learned more about linking methyltransferases to their methylation scheme.


If researchers attempt to introduce foreign DNA into an organism, such as when the genes required for manufacturing some important chemical are introduced into bacteria that are supposed to start making that chemical. Often, a host will reject this foreign DNA. The methylation patterns on the DNA molecule indicate that it's not native, and the host cell will destroy it. Bacteria that are commonly used in the lab, like E. coli, can usually withstand the introduction of foreign DNA and won't chop it up, but many other microbes will, impeding research.
Este video explica el proceso de metilación del ADN y su importancia en la transcripción eucariot usando metilasas de ADN y metilasas de histonas. Para más información: http://shomusbiology.weebly.com/ Para descargar material: http://shomusbiology.weebly.com/bio-m... Fuente: Dr. Anindita Banerjee, Department of Microbiology, St. Xavier's college

"Knowing which enzyme does what opens up to a lot of applications. With this knowledge, you can construct model organisms with artificial methylomes, mimicking the methylation pattern of the strain you want to introduce DNA to. In this way you can ensure [the] survival of introduced DNA," said the first author of the study, Specialist Torbjørn Ølshøj Jensen of The Novo Nordisk Foundation Center for Biosustainability (DTU Biosustain) at the Technical University of Denmark (TUM).

"Working in other bacteria than E. coli, you often have to do a lot of trial and error when it comes to DNA transformation, but that's just not good enough. You need knowledge and tools. With this, you have a systematic and rational way of fixing the problems," explained Jensen.

Working towards that goal, the researchers aimed to find what enzyme was creating which methylation pattern. They created circular strands of DNA (plasmids) that carried a methyltransferase gene. These were coupled with multiple copies of a specific DNA sequence, which were intended to be targets for the methyltransferase enzymes encoded by the plasmid. The team repeated this study for every methyltransferase.


The researchers could then observe the specific impact of individual methyltransferases by detecting the methyl groups on the target DNA sequences.

The scientists confirmed their results by assessing the genomes of two microbes used in manufacturing. Together, they carry 23 genes for methyltransferases, with twelve methylation patterns on their DNA. This suggested that not all their methyltrasnferases were at work, so the scientists looked for active methyltransferase genes in the bacterial genomes. After investigating the methylation patterns, they traced eleven of the twelve back to specific genes. This work can help create clearly defined 'methylomes' that describe methylation patterns in hosts, and make adding foreign DNA to these hosts easier
https://www.labroots.com/trending/genetics-and-genomics/15462/revealing-epigenetic-patterns-specific-enzymes-create?fbclid=IwAR3v3I-DwlyTDWX6rcx-C4Lxs-kcBjGVOGdvR8mwTVaIC6BkYCPmUxHQHU8

lunes, 11 de noviembre de 2019

¿Qué es la hipótesis del mundo ARN?

Me ha encantado esa comparación de que la célula en el fondo es la casa que protege y sostiene el mundo ARN.
 Introducción a los virus por David Baltimore, ¡Si, el autor de la clasificación Baltimore de los virus!

El sistema Baltimore divide los virus en siete grupos. Puedes ver las características básicas de cada grupo, entre ellas, su material genético y la vía que usa para fabricar ARNm, en el siguiente diagrama: Flecha verde = síntesis de un ARNm; flecha verde punteada = uso directo del genoma viral como un ARNm. Imagen modificada de "La clasificación de grupos de virus de Baltimore en familias depende de su tipo de genoma, por ViralZone/Swiss Institute of Bioinformatics, CC BY-NC 4,0.


Código genético y la relación clonal entre los distinto códones. Fuente
. Fuente



PREGUNTA: Tenemos un ORF:  ATGTATGGATACGCCTCTTCGGAGGGCAACTTAGAATAA
y a partir de esta secuencia tenemos una descendencia en la que se pueden observar tres mutantes:
Mutante 1:
ATGAATGGATACGCCTCTTCGGAGGGCAACTAGAATAA
Mutante 2:
ATGTACGGGTACGCATCGTCGGAGGGAAATTAGAATAA
Mutante 3:
ATGATATGGATACGCCTCTTCGGAGGGCAACTAGAATAA

¿Cuál de los mutantes tendrá más mutaciones? ¿Cuál de los mutantes será el que tenga menos? ¿Cómo afectarán esas mutaciones a la proteína resultante? Para ello traduce cada triplete utilizando la tabla 

SOLUCIÓN:
ORF: ATG TAT GGA TAC GCC TCT TCG GAG GGC AAC TAG AAT AA

1      ATG AAT GGA TAC GCC TCT TCG GAG GGC AAC TAG AAT AA

2      ATG TAC GGG TAC GCA TCG TCG GAG GGA AAT TAG AAT AA

3      ATG ATA TGG ATA CGC CTC TTC GGA GGG CAA CTA GAA TAA

PREGUNTA: Cuando no existían bacterias toda la vida sobre la Tierra era vírica. Eran protovirus de ARN que tenían ribosomas. Estos virus se replicaban en la sopa biológica (en Ecuador en el locro biológico). Cuando aparecieron las bacterias, éstas tenían una membrana que diferenciaba fuera de dentro. Las bacterias metieron dentro todo lo que les interesaba de la sopa biológica. Los protovirus al quedarse sin su alimento sufrieron una presión selectiva que favoreció a aquellos virus que sabían como penetrar en el interior de las bacterias y alimentarse de lo que antaño había sido suyo. Nacieron los virus como entidades parásitas de las células. Muchos biólogos siguen diciendo, de forma equivocada, que los virus no son entidades vivas porque se tienen que alimentar de una célula metabólicamente activa. Si es por eso, podríamos incluir en la categoría de virus a muchas personas que no son capaces de subsistir sin su tarjeta de crédito. ¿Cómo perdieron los protovirus sus ribosomas? porque hoy en día los virus actuales no tienen ribosomas. Como siempre la solución está en la selección natural. Imaginemos dos virus A y B. El virus A es un protovirus, tiene ribosomas, y su ARN tiene 60.000 bases. El virus B perdió los genes de los ribosomas y por esa razón tienen 40.000 bases. No necesita codificar ribosomas porque puede utilizar los de la bacteria que infecta. Ambos virus infectan y se replican en el interior de bacterias. Si la ARN polimerasa copia a una velocidad de 1000 bases por minuto y los cromosomas de A y B tienen un solo Ori. ¿Cuánto tiempo tarda cada virus en replicarse? ¿Cuánta descendencia tendrá cada virus al cabo de seis horas?

SOLUCIÓN: Virus A 30 minutos virus B 20 minutos. En seis horas tendremos de A  4096 virus, y de B tendremos 262144 virus. Si en vez de horas hablásemos de miles de años podemos entender porqué los virus actuales carecen de ribosomas.

PREGUNTA: ¿Qué fue antes el huevo o la gallina? ¿Qué proceso ocurrió antes en la evolución, el paso de ADN a ARN o el paso de ARN a proteínas? 

sábado, 9 de noviembre de 2019

Veintidós niños huérfanos coruñeses llevaron la vacuna por todo el mundo

El descubrimiento de la vacuna por Edward Jenner se publica en el año 1800. En 1803 sale de A Coruña una goleta con 22 niños huérfanos. A uno de esos niños se le ha inoculado el virus de la viruela de vaca, que protege a los humanos de la mortal viruela humana. Cuando a este niño le salen unas pequeñas pústulas, la única manifestación del virus de la vaca, los médicos pinchan la pústula y se la inoculan a otro niño. De esa manera, la Expedición Balmís, lleva el virus de la vaca, la vacuna, viva desde A Coruña a América. En Quito, la población se vacunó de manera masiva en 1805. Todavía no hay en la ciudad de Quito una calle, o un monumento que mencione esta gesta.
Fuente
Para saber más, pinchad aquí. Se trata de un artículo excelente de Laura Garofano publicado en el Mundo.



viernes, 8 de noviembre de 2019

Si soy capaz de transmitirme seré un parásito exitoso

El que vive a expensas de otros debe transmitirse una vez que ha agotado a su presa. La transmisión es una de las características de los patógenos. Pueden transmitirse por el agua, por el aire, o a través de animales hematófagos (se alimentan de sangre). Son los vectores, organismos vivos que pueden transmitir enfermedades infecciosas entre personas, o de animales a personas:

Las seis estructuras chupadoras de un mosquito buscando un capilar sanguíneo
Mosquitos. Los mosquitos han cambiado la historia de la humanidad, especialmente los géneros Aedes, Anopheles y Culex
Flebótomos, su picadura es el medio de transmisión de la leishmaniasis, de la bartonelosis y de algunas infecciones por arbovirus.
Las garrapatas transmiten encefalitis; enfermedad de Lyme; fiebre hemorrágica de Crimea-Congo; fiebre recurrente (borreliosis); ricketsiosis (fiebre maculosa y fiebre Q) y tularemia. Fuente
Triatominos: enfermedad de Chagas (tripanosomiasis americana). Fuente
Mosca tsetsé: enfermedad del sueño (tripanosomiasis africana). Fuente
Pulgas: peste (transmitidas por pulgas de las ratas al ser humano) y rickettsiosis. Fuente
Moscas negras: oncocercosis (ceguera de los ríos). Fuente
Caracoles acuáticos: esquistosomiasis (bilharziasis). Fuente
Piojos: tifus y fiebre recurrente transmitida por piojos. Fuente

miércoles, 6 de noviembre de 2019

¿Por qué los holandeses son tan altos?

Campesinos holandeses comiendo papas. Litografía de Van Gogh. Museo Thyssen, Madrid. Fotografía del autor del blog
PROBLEMA: Los holandeses en 1860 eran, como colectivo, de los más bajos de Europa. Ello era debido a que tenían una dieta pobre, basada en las papas y el maiz, y bebían agua contaminada. Holanda, como país, tiene gran parte de su territorio por debajo del nivel del mar. Gracias a unos diques, los polders, evitan que el mar inunde estas áreas. Por ese motivo, la capa freática se encuentra muy superficial. Como siempre ha tenido una cabaña ganadera muy importante, especialmente vacas, acordaros de sus famosos quesos, el agua en el siglo XIX se encontraba contaminada. Cuando variaron su dieta y empezaron a purificar el agua la altura de los holandeses pasó de 1.64 cm de media a 1.84 cm ¡Un aumento de 20 cm! SOLUCIÓN: una dieta variada y sobre todo, beber agua potable, hizo que aumentasen de tamaño



John Snow establece una relación epidemiológica entre el agua contaminada de heces y los brotes de cólera
En 1854 John Snow demuestra que el agua contaminada es el agente propagador de la cólera en Londres. En la fotografía, una de las bombas que se empleaban en el S XIX para proporcionar agua a la población
John Snow hizo un rastreo de las familias que presentaban casos de cólera y se dió cuenta que todas vivían alrededor de algunas bombas de agua. Curiosamente todas esas bombas pertenecían a la red de una empresa de suministro de aguas que tomaba el agua del Támesis, pero en vez de tomarla río arriba, tomaba el agua río abajo, cuando ya había sido contaminado con las heces de los habitantes de esta ciudad, muchos de ellos con cólera, con lo que se establecía un ciclo de contaminación fecal-oral.
John Snow, padre de la epidemiología moderna, cartografía los brotes de cólera y descubre que todos están asociados con bombas de agua contaminada con heces. En esa época no estaba claro el origen de las enfermedades infecciosas y muchos pensaban que las enfermedades las producían emanaciones de sitios pantanosos.
Fuente
En este gráfico se puede ver la evolución de las muertes causadas por agentes infecciosos por cada 100.000 habitantes en los USA durante el siglo XX. Alrededor de 1910 se implementó la cloración del agua en las ciudades de los EEUU. Se puede ver el impacto de esta medida en la drástica reducción de muertes por enfermedades infecciosas.

La higiene corta la transmisión fecal-oral

Eugenio Espejo, Ignacio Semmelweis, Joseph Lister... fueron pioneros en introducir la idea de que para parar las infecciones había que impedir la transmisión del agente causante de la infección. La vía de contaminación fecal-oral es la más habitual. Es decir, la que va desde las heces de personas o de mamíferos a la boca de otros seres humanos.
En el Ecuador se pueden observar filtros de piedra volcánica en casas y museos. El filtro funciona como un cedazo que impide que la bacteria o el parásito atraviese el filtro con lo que se interrumpe la vía de transmisión.

En Quito, la actual calle Guayaquil, se llamaba churretas, porque era una escorrentía de las churretas de porquería de la ciudad hacia la quebrada 24 de mayo. En tiempos de Eugenio Espejo, la ciudad de Quito, carecía de alcantarillado. De manera muy sagaz, el Dr. Espejo, intuyó que las personas contraían enfermedades de solo caminar por esas calles inmundas.
Filtro volcánico de piedra. Museo Casa del General Sucre en Quito
En Ecuador, se pueden observar filtros de piedra volcánica en la Casa del General Sucre en Quito. La existencia de estos filtros hablan de una comunidad preocupada por la limpieza y pureza del agua. Si tenemos en cuenta que el General Sucre compra su casa en 1828 y que en 1854 John Snow demuestra que el agua contaminada es el agente propagador de la cólera en Londres y que en 1860 es cuando Luis Pasteur establece la teoría microbiana de la enfermedad, estamos hablando de unas gentes que ya se preocupaban de la higiene.
Para saber más:
https://www.huffpost.com/entry/why-are-the-dutch-so-tall_b_5544085

miércoles, 23 de octubre de 2019

Si los problemas generan valor deben ser mantenidos

Un amigo psicólogo lee la noticia: La resistencia a antibióticos se duplicará en 20 años, y se acordó de mi. Las noticias de calamidades no cuentan que uno de los factores de este problema es que, en nuestro sistema económico, las calamidades generan beneficio, y por tanto convienen. El escritor Phillip K. Dick ya intuyó en una de sus obras esta paradoja.

En el Decámeron, Bocaccio, ya hablaba de la imposibilidad de escapar de la peste en 1353. Pandemias víricas, bacterias resistentes a los antibióticos, pérdidas de ganado por enfermedades contagiosas... son problemas que deben tratarse de manera multidisciplinar. Pero quizás haya quien con estos problemas esté ganando dinero. Si es así, estas personas y estos intereses deberían ser considerados también parte del problema.  
De los cuatro Jinetes de la Apocalisis, el cuarto representa a la peste, es decir, las pandemias capaces de segar las vidas de una tercera parte de la población. Las enfermedades infecciosas siempre han estado en el imaginario humano
El concepto One Health es una estrategia para aumentar la comunicación y la colaboración interdisciplinar en el cuidado de la salud de las personas, los animales y el medio ambiente, a nivel mundial, entendiendo que todas están ligadas entre sí. Surge la Iniciativa One Health de la mano de dos médicos, Laura H. Kahn y Thomas P. Monath, y un veterinario, Bruce Kaplan, en 2006. Esta iniciativa ha ido incluyendo posteriormente a más investigadores del ámbito de la salud, médicos y veterinarios expertos en salud pública a nivel mundial. Quizás habría que incluir también a economistas si el problema es también un problema de intereses económicos.
La producción industrial de carne es para los microorganismos un nicho ecológico fantástico en donde transmitirse sin problema

Donde hay escasez hay beneficio
El escritor de ciencia ficción, Phillip K. Dick, ha sido llevado a las pantallas en al menos 12 de sus obras. El mérito de este autor no es literario porque escribe bastante mal, de forma deslavazada, sin demasiado cuidado. Sin embargo, de repente, es capaz de crear páginas icónicas como el famoso: "Yo he visto cosas que ustedes no creerían. Naves de ataque en llamas..." en donde se plasma la adquisición del alma por un replicante, un producto de la ingeniería genética.

En su novela Podemos recordarlo todo para usted que originó la película "Total recall" describe como, en Marte, las autoridades conocen la existencia de una máquina de origen extraterrestre capaz de generar oxígeno suficiente para crear una atmósfera como la de la Tierra. Sin embargo, las autoridades mantienen esa fábrica cerrada y en secreto porque la mejor manera de mantener a los habitantes humanos de Marte controlados es con el suministro limitado de oxígeno. Phillip K. Dick nos muestra, con la inquebrantable fe del visionario, que el capitalismo no busca solucionar problemas, sino que los problemas, si generan valor, son bienvenidos.
Venky: familias felices comiendo pollo y bacterias resistentes a la colistina, un antibiótico utilizado contra las bacterias multirresistentes. O te mueres de hambre o te mueres de una bacteria multirresistente ¿Debemos elegir entre esta alternativa?
La estrategia one health no logrará éxito si no se tiene este factor en cuenta. En este blog ya hablamos de la empresa india Venky. Una empresa que es la mayor productora de carne de pollo en la India y que a su vez es también productora de antibióticos, algunos de ellos como la colistina, la última barrera antibiótica frente a ciertas bacterias resistentes. ¿De qué sirve investigar cepas bacterianas con resistencia a la colistina si se puede comprar este antibiótico por kg en internet? Si se usa un antibiótico de manera masiva se van a seleccionar bacterias mutantes con modificaciones en los fosfatos del lípido A y por tanto indiferentes a la acción letal de este producto. Esto hará que algún otro antibiótico suba su precio. El problema ha sido originado por la avaricia de un productor sin escrúpulos. La aparición de bacterias mutantes hará que este nuevo antibiótico se vuelva ineficaz y de nuevo habrá que migrar hacia otro. La situación es la óptica para un sistema que siempre busca excluir a la competencia. Es una realidad que parece ideal para el comportamiento del sistema económico en el que nos encontramos

viernes, 11 de octubre de 2019

Como limpiarse bien el culo

Es muy importante, sobre todo para las chicas,  limpiarlo de adelante hacia atrás. Hacerlo en sentido contrario es uno de los principales factores de riesgo de infecciones de orina.
 La flora intestina aerobia, los llamados coliformes, como Escherichia coli, Klebsiella, Enterobacter, son los principales productores de infecciones del tracto urinario, siendo E. coli responsable del 80% de estas infecciones.

viernes, 27 de septiembre de 2019

Cistitis recurrentes en ancianos y bacterias sin pared celular


Existen dos grandes tipos de bacterias, las más antiguas, las arqueobacterias, que viven en sitios extremos como aguas termales. Estas bacterias son los primeros seres vivos con membrana plasmática que existieron en el planeta Tierra. Por eso todavía viven en aquellos lugares que asemejan a como era el planeta hace 4000 millones de años. El otro gran grupo es el de las eubacterias, o bacterias verdaderas, es decir, aquellas que causan problemas a los humanos. Como somos tan antropocéntricos las llamamos verdaderas :)
Las eubacterias, a diferencia de las arqueobacterias, están rodeadas de una malla de peptidoglicano. Esta malla les proporciona una protección porque su interior tiene presión, como los neumáticos. La función de esta malla es evitar que la presión interna celular haga explotar.

Las bacterias cuando se dividen tienen que ir aflojando la malla para poder crecer y al mismo tiempo tienen que crear más malla y anudarla para evitar que la presión interna les haga explotar. Los antibióticos tipo penicilina impiden que se anude la nueva malla. Esto hace que la presión interna haga explotar a la bacteria. Así es como funcionan estos antibióticos.
A la izquierda, bacterias creciendo en presencia de penicilina. A la derecha bacterias creciendo sin penicilina ¿Se ve la diferencia?

Lo normal es que todas las eubacterias tengan esa pared celular formada principalmente por la malla de péptidoglicano, pero como siempre en biología, existen eubacterias que por ciertas circunstancias pueden carecer de la pared celular de peptidoglicano, son las llamadas formas L porque se descubrieron en el Instituto Lister de Londres.
¿Qué es una forma L? son bacterias sin pared celular. Algunas bacterias Gram negativas pueden convertirse a Formas L en medios con osmolaridad normal o fisiológica.

Investigadores del Hospital Newcastle Freeman encontraron cepas de E. coli, Enterococcus, Enterobacter y Staphylococcus en cistitis de pacientes ancianos con infecciones recurrentes.

A continuación, las cultivaron en el laboratorio y procedieron a grabar en video cómo se comportaban frente a antibióticos que atacan la pared celular como las penicilinas y derivados. Se podía ver como en presencia del antibiótico las bacterias carecían de pared celular y que solo cinco horas después de haber sido obtenidas del paciente comenzaban de nuevo a fabricar una pared celular.
Infectaron con estas bacterias peces transparentes, los famosos peces cebra, y observaron el mismo fenómeno. De esa manera, comprobaron que lo que se había observado in vitro también ocurría in vivo. En la fotografía laboratorio de cría de peces cebra

Las formas L son muy delicadas. Las bacterias en forma L no podrían sobrevivir en personas sanas ya que las defensas de su organismo atacarían a estas bacterias más vulnerables. Sin embargo, en ancianos o individuos inmunodeprimidos la reacción defensiva no sería suficiente para acabar con todas. Por eso, bajo las conclusiones del estudio, es importante utilizar nuevas estrategias en este tipo de pacientes. Por ejemplo, utilizar un tratamiento formado por dos fármacos, un antibiótico dirigido a la pared celular, que estimularía que pasaran a forma en L, y otro que terminara de fulminar a los microbios debilitados que quedaran después.

También es importante tener en cuenta este hallazgo de cara al diagnóstico, pues han descubierto que las bacterias en forma de L estallan y desaparecen por el efecto del gel empleado en las técnicas de diagnóstico empleadas normalmente en el hospital, de modo que se formarían falsos negativos.

Referencia:
https://www.nature.com/articles/s41467-019-12359-3