lunes, 16 de mayo de 2022

O mía o de nadie

Las relaciones entre individuos se pueden resumir, como hemos visto, en competitivas, parasíticas y simbióticas. Las relaciones competitivas nos son fáciles de entender. Se basan en el egoísmo, "quítate tu pa ponerme yo". Adam Smith, intuyó que entender el interés personal de un compañero podría llegar a un intercambio mútuamente beneficioso bajo la premisa "dame lo que necesito y tendrás lo que deseas". Es decir, las relaciones competitivas no solo generan egoísmo en las relaciones. Las relaciones parasíticas tampoco es una depredación de recursos y una manipulación sin nada a cambio, en muchos casos. Estamos empenzando a entender estos procesos. En la simbiosis parece que se llega a una relación perfecta donde tu ganas y yo gano... Pero, no se llega a esta situación que en principio parece ideal de una manera cooperativa, altruísta, equilibrada. Un amarre ferreo sella el destino de ambos. Sin este amarre no hay posibilidad de un destino compartido. Ese amarre molecular "o mía o de nadie" lo inventaron los virus con los sistemas toxina-antitoxina.

O mía o de nadie

El egoísmo, la extrema hijoputez, es ligar un territorio a ti de manera indisoluble. El machista quiere que su mujer le pertenezca de manera que la única forma de librarse de ellos sea con los pies por delante. O la madre posesiva que prefiere ver a su hija muerta antes que de otro. Los virus inventaron este egoísmo de una manera elegante. En su genoma llevan dos genes: uno codifica para una toxina, o un veneno, como quiera decirse. El otro gen es un antídoto que anula la actividad tóxica del veneno. El truco está en que la molécula del antídoto es lábil, es decir, se deteriora rápidamente. Tiene que estar produciéndose constantemente para anular a la toxina. 

Fig. 1. Si una bacteria es portadora de ADN vírico egoísta, compuesto de un gen de toxina y otro antídoto, va a producir toxina y su antídoto. Si, al dividirse la bacteria, una hija (b) lleva el ADN vírico egoísta va a seguir produciendo toxina y antídoto, con lo cual la bacteria puede vivir su vida tranquilamente (d). Si al dividirse una de las hijas (c) carece de ese ADN vírico no va a poder producir nuevas toxinas y lo que es más importante: nuevos antídotos. Como el antídoto es una molécula lábil, de vida media corta, cuando desaparece la toxina todavía está en el interior de la célula y la mata. De esta manera se consuma el "o mía o de nadie". 

Las bacterias que no amaban a los machos

Imagina una bacteria que hubiera infectado a un millón de especies distintas, especializándose en introducirse en lo ovarios y los testículos de sus huéspedes. Imagina también que en ocasiones esa bacteria se dedicase a aniquilar a casi todos los machos y además, como si fuera un arcángel parásito, fuese capaz de provocar embarazos espontáneos en las hembras. Imagina también que, desde su cálido hogar en los genitales de los animales a los que ha infectado, esta bacteria hiciese que dos poblaciones vecinas de una misma especie ya no pudieran aparearse con éxito. Pues bien, esa bacteria existe y se llama Wolbachia, la bacteria parásita más exitosa del mundo capaz de infectar a un millón de especies distintas de invertebrados. La lista de especies va desde mariposas, avispas, moscas, saltamontes, pulgas, termitas, gusanos. No infecta vertebrados, por tanto los humanos estamos libres de esta plaga afortunadamente. Para los playboys piscineros que sueñan en vivir en un harem es una desgracia ya que una vez que Wolbachia infecta una especie esta bacteria es capaz de conseguir que haya hasta 99 hembras por cada macho.

Wolbachia es maestra en el arte de manipular el sexo de las especies que parasita porque necesita a las hembras para perpetuarse. Wolbachia vive dentro de las células de su hospedador de las que nunca sale. ¿Cómo hace para perpetuarse e infectar a otros individuos? Wolbachia ha resuelto este problema infectando los óvulos de las hembras. De esta manera se transmite a los descendientes de las hembras. Los machos son para ella un callejón sin salida porque al ser el espermatozoide tan pequeño no pueden introducirse en el para viajar de los machos a las hembras. Solución: fuera machos. Para eliminar a los machos esta gran manipuladora puede utilizar diferentes estrategias: la más común y más estudiada es la incompatibilidad citoplasmática, que hace que un macho infectado por Wolbachia sólo puede tener descendencia con hembras infectadas (Ver próxima entrada); algunos tipos de Wolbachia feminizan a los machos modificando sus niveles de hormonas de forma que puedan poner huevos; otra estrategia utilizada es matar a los machos cuando estos están en fase de embrión; y por último la partenogénesis en donde la hembra tiene hijos sin necesidad del esperma de un macho.

Los parásitos como Wolbachia encuentran siempre su propio camino para entender la biología de su hospedado y hacer que obedezcan sus órdenes. Es más fácil vivir dentro del cuerpo de un invertebrado que en el cambiante mundo exterior. Los organismos superiores somos más predecibles, sobre todo en cuestión de sexo y por ello más manipulables.
Fig. 2. Fotografía de microscopía de fluorescencia de Wolbachia (verde) en el interior de los testículos de un insecto. En rojo se muestra el esperma. Cortesía Michael Clark y Seth Bordenstein. Las bacterias Wolbachia viven en el interior de las células de los invertebrados infectados, también en el interior de los óvulos de las hembras. En los machos viven también en el interior de los testículos, pero son incapaces de introducirse en el interior de los espermatozoides. De esta manera las hembras infectadas transmiten la bacteria a sus hijos por lo que la bacteria favorece que haya el mayor número de hembras a expensas de los machos que para Wolbachia son un callejón sin salida

Fig. 3. Incompatibilidad citoplasmática. La toxina que produce Wolbachia deforma el ADN de los espermatozoides. Al mismo tiempo en los óvulos secreta un antídoto que corrige esta deformidad. Por eso un macho infectado por Wolbachia sólo puede tener descendencia con una hembra infectada. 

Incompatibilidad citoplasmática: como se ve en el diagrama un macho infectado por Wolbachia sólo puede tener descendencia con hembras infectadas, si este macho infectado copula con una hembra sana su esperma inviable no daría lugar a descendencia. En cambio las hembras infectadas, las que transmiten la bacteria, pueden tener descendencia tanto con machos sanos como con machos infectados. Esta estrategia hace que las hembras sanas estén en inferioridad de condiciones respecto a las hembras colonizadas por Wolbachia. Esta es una de las claves por las que uno de cada cinco insectos es portador de esta bacteria.¿Cómo lo hace Wolbachia? la bacteria secreta una toxina en los testículos que deforma el ADN de los espermatozoides. Al mismo tiempo en los óvulos secreta un antídoto que corrige esta deformidad. Por eso un macho infectado por Wolbachia sólo puede tener descendencia con una hembra infectada.
Fig. 4. Feminización. En algunas especies de Wolbachia permite que nazcan machos, pero altera sus hormonas de manera que los feminiza y los hace capaces de producir huevos. 
Fig. 5. Feminazización. Algunas especies de Wolbachia son capaces de matar a los embriones machos

Fig. 6. Wolbachia es capaz de alterar el estado hormonal de las hembras de manera que los huevos se convierten en embriones sin necesidad del esperma del macho. Todos los embriones fecundados sin esperma se convierten en hembras, las cuales también pueden dar procrear sólo hembras.

Gracias a herramientas como ésta, Wolbachia manipula las poblaciones de sus hospedadores, de manera que en vez de tener poblaciones en donde la mitad son machos y la otra mitad hembras resulta que por cada 99 hembras hay un solo macho. Obviamente cuando se llega a esos extremos las hembras viven una situación de intensa competencia por los machos que como podemos imaginar viven acosados y extenuados.

La carrera de armamentos de Wolbachia y sus hospedadores 

El investigador Greg Hurst del University College de Londres descubrió que la mariposa Hypolimnas bolina la cual tenía una relación de 99 hembras por cada macho, en los años 2005 al 2006 cambió esta relación a la de 60 hembras por cada 40 machos. Este cambio se produjo en solo 10 generaciones debido a una variante genética que hacía que la toxina de Wolbachia no funcionase. Obviamente las mariposas sin Wolbachia se reprodujeron más y mejor reestableciendo el equilibrio entre sexos. Este fue un caso claro de evolución en acción en un espacio de tiempo reducido.

Wolbachia como barrera intraespecífica

El parasitismo de Wolbachia podría ser una explicación del porqué existen tantas especies distintas de insectos. Imaginemos que en vez de infectar invertebrados Wolbachia infectase personas. Imaginemos que una cepa de Wolbachia, llamémosla A, infecta a franceses, mientras que en España, una cepa B infecta españoles. Si el antídoto de la cepa A no funciona para la toxina de la cepa B y viceversa ¿Qué ocurriría? el resultado sería que los españoles no podríamos tener hijos con franceses ni los franceses con españoles. Esto convertiría técnicamente a españoles y franceses en especies distintas. Si eliminásemos las bacterias con un antibiótico entonces todo volvería a se como antes.

Esto mismo fue lo que hizo el investigador Jack Werren de la Universidad de Rochester con las avispas Nasonia. En la avispa Nasonia hay poblaciones que están colonizadas por una clase de Wolbachia que llamaremos cepa A, y otra población colonizada por la cepa B. Jack Werren observó que si intentaba aparear Nasonia portadora de la cepa A con Nasonia portadora de la cepa B, los embriones resultantes eran inviables. Esto es así por que el antídoto que produce la cepa A sólo corrige los defectos en el esperma de los machos colonizados con la cepa A, y lo mismo ocurre en las avispas colonizadas por la cepa B. Cuando Jack Werren trató las avispas con un antibiótico que eliminó las bacterias, entonces fue posible tener embriones viables cuando se apareaban las dos poblaciones de avispas colonizadas por cepas distintas de Wolbachia. Esto quiere decir que cuando la avispa Nasonia estaba colonizada con dos cepas distintas de Wolbachia cada población era una especie diferente ya que no podían cruzarse entre si. Pero si ambas poblaciones están libres de la bacteria, o las bacterias son eliminadas de la población de avispas con un antibiótico en este caso no hay barreras para el apareamiento entre ambas poblaciones.

Especies como matrioskas rusas

Las especies como matriuskas rusas: un saltamontes colonizado por una bacteria que vive dentro de sus células. Esta bacteria, a su vez contiene a su vez un virus. El virus le proporciona a la bacteria herramientas moleculares para que la bacteria se mantenga en la Especies como matrioskas rusaspoblación de saltamontes. De esta manera en un ejemplar de saltamontes infectado tendremos al saltamontes, la bacteria y el virus todo en uno. Pero aun hay más. Recientemente el grupo de McMeniman de la Universidad de Queensland ha conseguido infectar mosquitos transmisores del virus del Dengue con Wolbachia, otros grupos han descubierto que el gusano que causa la filariasis, una enfermedad tropical que afecta a 120 millones de personas, está a su vez infectado con la bacteria Wolbachia, y que si matan a la bacteria con un antibiótico, el gusano por si mismo no puede sobrevivir. De esta manera están administrando antibiótico a los enfermos de filariasis como tratamiento coadyuvante con éxito. Todo esto nos indica que a este sistema de tres bandas: virus, bacteria e invertebrado hay que añadir ahora un nivel más de complejidad, la tecnología que empleará la bacteria para mejorar la salud de otra especie, la nuestra.
Fig. 7. La ceguera de los ríos es la segunda causa de ceguera infecciosa en todo el mundo. Se transmite a los seres humanos por medio de la picadura de las moscas negras infectadas con el gusano parásito Onchocerca volvulus, que a su vez, tiene a la bacteria endosimbionte Wolbachia viviendo en sus genitales. 

Hasta ahora se pensaba que la enfermedad estaba causada por gusanos parásitos que construyen túneles en la piel y liberan millones de larvas que se distribuyen por todo el cuerpo hasta provocar una reacción inmune que conlleva la inflamación de los ojos y, posteriormente, ceguera. Parece ser que no son los parásitos los culpables sino la bacteria Wolbachia que vive en ellos. De hecho, es la responsable de la inflamación que acaba en ceguera y provoca además graves problemas en la piel. Si es una bacteria la responsable entonces podemos tratar esta enfermedad con antibióticos.

jueves, 12 de mayo de 2022

Detección de Legionella pneumophila por amplificación isoterma LAMP

En España es frecuente, sobre todo en verano, leer en la prensa que en determinada ciudad ha habido un brote de Legionella pneumophila. Suele causar alarma porque L. pneumophila es una bacteria que tiene una tasa de mortalidad elevada, entre 15-25% si afecta a pacientes inmunocomprometidos, fumadores, ancianos... El procedimiento es siempre el mismo: se busca por torres de refrigeración de centros comerciales, hospitales... El CDC nos informa que son en las torres de refrigeración, que emplean agua para enfriar el aire, en donde, por ausencia de limpieza puede crecer Legionella pneumophila. Los aires acondicionados caseros, o de los automóviles, no emplean agua para refrigerar por lo que no pueden ser fuentes de Legionella.


Para detectar Legionella se puede usar amplificación por LAMP, PCR o cultivo en medio selectivo. De los tres el más sensible es la amplificación isoterma LAMP.

También se puede detectar por real-time PCR.

Para identificar a Legionella pneumophila se emplea el gen mip (gene ID LPG_RS03920  Protein accesion Q5ZXE0.2). Este gen codifica para una proteína que potencia la infección de la bacteria en macrófagos.

>NC_002942.5:866850-867551 Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete sequence


ATGAAGATGAAATTGGTGACTGCAGCTGTTATGGGGCTTGCAATGTCAACAGCAATGGCTGCAACCGATGCCACATCATTAGCTACAGACAAGGATAAGTTGTCTTATAGCATTGGTGCCGATTTGGGGAAGAATTTTAAAAATCAAGGCATAGATGTTAATCCGGAAGCAATGGCTAAAGGCATGCAAGACGCTATGAGTGGCGCTCAATTGGCTTTAACCGAACAGCAAATGAAAGACGTTCTTAACAAGTTTCAGAAAGATTTGATGGCTAAGCGTACTGCTGAATTCAATAAGAAAGCGGATGAAAATAAAGTAAAAGGGGAAGCCTTTTTAACTGAAAACAAAAACAAGCCAGGCGTTGTTGTATTGCCAAGTGGTTTGCAATACAAAGTAATCAATTCTGGAAATGGTGTTAAACCCGGAAAATCGGATACAGTCACTGTCGAATATACTGGTCGTCTGATTGATGGTACCGTTTTTGACAGTACCGAAAAAACTGGTAAGCCAGCAACGTTCCAGGTTTCACAAGTTATCCCTGGATGGACAGAAGCTTTGCAATTGATGCCAGCTGGATCAACTTGGGAAATTTATGTTCCCTCAGGTCTTGCATATGGCCCACGTAGCGTTGGCGGACCTATTGGCCCAAATGAAACTTTAATATTTAAAATTCACTTAATTTCAGTGAAAAAATCATCTTAA

Página con programa para generar el complementario y el reverso del ADN https://www.bioinformatics.org/sms/rev_comp.html

Página con programa para diseñar los primers LAMP https://lamp.neb.com/

 

miércoles, 11 de mayo de 2022

La ciencia, al igual que los árboles, tiene sus raíces

Las personas somos un eslabón entre la generación que nos ha criado y la generación que nosotros criamos. Conviene recordarlo. Además de nuestros hijos, en el ámbito laboral nosotros nos formamos de nuestros maestros y formamos la generación que viene detrás. No solamente producimos ideas, publicamos artículos, defendemos nuestro trabajo... también somos responsables de la educación de aquellos que dependen de nosotros para formarse. 

La ciencia, al igual que los árboles, tiene sus raíces. En la fotografía árbol y hojas de la quina

Cuando comencé mi tesis doctoral, sobre cómo las fluoroquinolonas inhiben la actividad de las topoisomerasas, no tenía ni idea de quien había descubierto las propiedades curativas de la quina. La quina es un árbol del Ecuador. Sus propiedades curativas fueron descubiertas por el chamán Pedro Leiva. Posteriormente se aisló la molécula que posee el principio activo, la quinina. A esta molécula cuando se le añadió por síntesis orgánica un átomo de fluor se comprobó que tenía actividad antibiótica. Hoy en día las fluoroquinolonas son uno de los tres grupos de antibióticos más exitosos. ¿Qué une a un chamán ecuatoriano del siglo XVIII con un estudiante gallego de finales del siglo XX? Pues si, la molécula de la quina y sus propiedades antibióticas.

Molécula de la quinina que se extrae del árbol de la quina

El naturalista deviene en microbiólogo

Cuando era pequeño disfrutaba inmensamente de la naturaleza. Por eso me decidí por estudiarla. Al acabar mis estudios de grado me interesé en dos áreas de investigación, la genética de desarrollo y la microbiología. Me decidí por esta última por dos razones: el problema de salud pública que ya se intuía en el problema de las bacterias resistentes y el impacto tan rápido que tiene la selección natural en las poblaciones bacterianas. Gracias a una beca FPI de la Comunidad de Madrid pude realizar mi doctorado con la Dra Adela G. de la Campa en el Instituto de Salud Carlos III estudiando el mecanismo por el cual las fluoroquinolonas inhibían las topoisomerasas. Este trabajo me permitió aprender a secuenciar genes, caracterizarlos, clonarlos, expresarlos y realizar ensayos enzimáticos. Al acabar el doctorado me mudé a Ann Arbor, Michigan para trabajar en patogénesis microbiana. Fui becado por la MEC-Fullbright durante dos años. En el laboratorio de Michelle Swanson establecimos un modelo en el que Legionella pneumóphila inhibía la maduración del fagosoma liberando lipopolisacáridos de su membrana. Este trabajo recibió el Primer Premio Internacional Alcora de investigación en Legionelosis. 

Regresé a España con un contrato Isidro Parga de la Xunta de Galicia para trabajar en el INIBIC de A Coruña. En este periodo caractericé la actividad apoptótica y autofágica de una porina de Acinetobacter baumannii. Aquí realicé el trabajo del que estoy más satisfecho: comprobar por primera vez que las vesículas de membrana de A. baumannii podrían ser un vehículo para transformar horizontalmente otras especies como A. baylii. Durante este periodo, conseguí tres proyectos de divulgación científica y el entonces director del Museo Nacional de Ciencia y Tecnología me pidió colaborar para la construcción del museo en la ciudad. Posteriormente, en 2014 me mudé al Ecuador para trabajar como investigador Prometeo y comencé a trabajar como profesor e investigador en la Universidad de las Américas en Quito desde 2015-2021 en que me mudé a la Universidad Espíritu Santo de Guayaquil. En este periodo he estado trabajando en la perspectiva “Una sola salud” colaborando con la Universidad Central del Ecuador, testando la actividad biológica de compuestos de síntesis orgánica en colaboración con el Dr. Jaime Charris, de la Universidad Central de Venezuela, con el que logramos el Premio Nacional de Ciencia y Tecnología 2021 que concede el gobierno venezolano. Por último, estamos comenzando a publicar trabajos sobre pedagogía y enseñanza da la microbiología.

Las leyes de hierro

Lo mismo que Robert Michels acuñó la ley de hierro de las oligarquías para explicar cómo funcionan los partidos políticos en ciencia, como organización, no se escapa de esos mismos principios. Los que determinan el devenir del proceso científico son los gestores, los políticos, los empresarios... por un lado, y por otro lado el inveterado deseo de las personas que se dedican a la ciencia por pagar su hipoteca. La lucha por sobresalir en este mundo es cruenta: no hay cama para tanta gente. Una de las habilidades que no se explican en la academia es el poder entender qué quieren tus empleadores, que quieres tu, qué papel juegas, cómo hacer alianzas... de todo ello depende el éxito en la carrera científica. 

Sin embargo, la ciencia retiene todavía algo del espíritu artesano, de la idea medieval de que tu trabajo te reconcilia con algo superior a ti mismo. Cuando observamos que los procesos tienen una lógica, esa lógica nos sirve como punto de apoyo, como área de descanso en medio del desorden que se percibe alrededor nuestro. Esa lógica nos hace tener confianza en nuestras fuerzas y discernimiento. 

Bacterias que degradan hidrocarburos aisladas de la boca del depósito de gasolina

Si se estudian nichos ecológicos extraños como la boca del depósito de gasolina de los coches, un lugar seco, sin agua, nadie esperaría observar bacterias. Pues bien, allí se encuentran Pseudomonas, Stenotrophomonas, Staphylococcus y Bacillus, algunas de las cuales han mostrado un claro patrón de degradación del gasóleo. Se ha encontrado una nueva especie de Isoptericola que es capaz de degradar el diésel. Estas bacterias se pueden utilizar en biorremediación, es decir, para devolver a su condición natural un medio ambiente afectado por la contaminación. 

The car tank lid bacteriome: a reservoir of bacteria with potential in bioremediation of fuel. Àngela Vidal-Verdú, Daniela Gómez-Martínez, Adriel Latorre-Pérez, Juli Peretó, Manuel Porcar. npj Biofilms and Microbiomes.

domingo, 8 de mayo de 2022

Las algas tóxicas acabaron con la civilización Maya

Una plaga de algas nocivas infestó los acueductos mayas entre los siglos VIII y X, enfrentándolos a una crisis de agua potable hace 1,000 años. Además, los científicos reconocen que la debilitación de las ciudades mayas no se debieron únicamente a la infección de sus suministros de agua. Por el contrario, el proceso fue paulatino y es multifactorial, concluyen en el estudio.



sábado, 7 de mayo de 2022

¿Qué fue antes el huevo o la gallina?

Fig. 1. La evolución es el reflejo del paso del tiempo en ese código

Cuando era pequeño se oía este tipo de pregunta ¿Quién fue primero, el huevo o la gallina? las personas que te lo preguntaban ponían cara de ¡Oh, gran enigma!. Después de 25 años de estudio de la biología puedo asegurar que primero es el huevo (Y aprovecho para poner cara de ¡Después de 25 años de estudio de la biología! pena que no tenga una perilla para atusármela). De hecho seguimos siendo un huevo. Desde un punto de vista biológico sólo somos un huevo. Me explico. Cuando se fecunda un óvulo, éste empieza a dividirse. A las pocas divisiones ya se sabe que células van a ser las células sexuales, esto es, las únicas células del cuerpo humano que tendrán la oportunidad de pasar a la siguiente generación. Nuestros cuerpos son solo el contenedor de esas células que tendrán la oportunidad de pasar a la siguiente generación. Por supuesto esta es una visión reduccionista, pero desde un punto de vista biológico sólo importa aquellas células que se transmiten, esto es, el huevo. Fuimos huevo porque procedemos de un protozoo unicelular, y seguimos siendo un protozoo unicelular, un protozoo que pasa el 99.999999999999999999% de su tiempo con sus cromosomas repartidos entre dos células haploides: el óvulo y el espermatozoide.

El huevo fecundado comienza a dividirse. Cuando forma un puñado de células es cuando se dirime cuáles van a ser células sexuales y cuales somáticas. Las somáticas seremos nosotros, los humanos. Nuestra tarea será la de procurarle a nuestras células sexuales un background genético, es decir, si somos varones tenemos que buscarle un óvulo a nuestro espermatozoide, si somos mujeres un espermatozoide para nuestro óvulo. Los humanos, desde un punto de vista biológico solo somos portadores de nuestras células sexuales hasta que se genere un nuevo huevo del que se desarrollará un nuevo ser al que llamaremos hijo.

Preguntar que fue antes el huevo o la gallina es una pregunta trampa, porque no contempla la línea de tiempo que va implícita en nuestra información genética. En la figura 1 se observa como en la evolución, el huevo tal como lo conocemos aparece mucho antes de que en la Tierra aparezcan las aves. Los reptiles, de los cuales proceden las aves, ya ponían huevos. 

Cuando se estudia embriología, que es la ciencia que estudia el desarrollo de los embriones tiene un dicho: "la ontogenia recapitula la filogenia". Para los estudiantes de biología es una revelación. Al estudiar cómo se desarrolla un embrión se observa claramente como ese huevo se divide, forma un organismo pluricelular con una diferenciación de células sexuales y no sexuales (somáticas), se observa como forma un saco y como ese saco se pliega, vemos como el embrión es una especie de reptil con cola, como esa cola se reabsorbe, vemos unas agallas primitivas y membranas entre los dedos que van desapareciendo. Vemos la evolución del ser humano en el desarrollo del embrión. 

En biología, normalmente, lo más sencillo aparece en la evolución antes que lo complicado. Como diría el genetista T. Dobzhansky "Nada tiene sentido en biología si no es a la luz de la evolución". La evolución no es otra cosa que la influencia del paso del tiempo en ese material genético. Cuando se estudia biología se suele hacerlo desde una perspectiva antropocentrista. Estudiamos la célula humana y cuando comenzamos a estudiar las bacterias decimos: no tienen núcleo, no tienen organelos, no tienen... Como si lo normal fuese la célula humana y lo demás excepciones. 

La primera célula fue una arqueobacteria. Cuando las cianobacterias llenaron la atmósfera de oxígeno, las arqueobacterias se retiraron de la superficie y se quedaron viviendo en lugares anóxicos, como fondo de mares, lagos, ríos, en el interior de la tierra... De las arqueobacterias aparecieron lo que nosotros llamamos bacterias verdaderas, más que nada porque como algunas causan enfermedades en humanos, son las que mejor conocemos. Bacterias como la del cólera, tuberculosis, disentería... A diferencia de las arqueobacterias, éstas son más pequeñas, no tienen citoesqueleto, son sacos a presión que evitan explotar gracias a una malla exterior de un material como de red que impiden que es presión interior las reviente.

La célula bacteriana es anterior en la evolución a la célula eucariota. 

Una arqueobacteria anaerobia fue parasitada por una eubacteria Gram negativa. Un estudio publicado por Martín Wu, plantea el siguiente escenario: las mitocondrias fueron bacterias Gram negativas que parasitaban el ATP de arqueobacterias. Con el tiempo, como veremos más adelante en este capítulo, fueron estrechando su relación con la arqueobacteriasy sólo se convirtieron en organismos simbióticos y por tanto beneficiosos cuando cambiaron de "chupar" el ATP a producirlo para el consorcio simbiótico. Por tanto, las células humanas proceden de una simbiosis entre bacterias. Es más, la célula eucariota surge por la simbiosis de varias bacterias, por ese motivo es más compleja. A esta teoría se le llama teoría endosimbiótica seriada, la cual explica que los hongos surgen de la simbiosis de esa bacterias Gram negativa y la arqueobacteria. Los animales habrían tenido otro evento simbiótico con una bacteria que les hubiese proporcionado la maquinaria molecular para la motilidad, y las plantas serían una célula con mitocondrias que además hubiese realizado una simbiosis con una cianobacteria con clorofila. De nuevo, de los más sencillo surge lo complicado.

Fig. 2. Cuando comenzó a aumentar la concentración de oxígeno en la atmósfera, las bacterias anaerobias, representadas de color azul comenzaron a desaparecer de la superficie de la Tierra. Fueron sustituídas por bacterias con capacidad de detoxificar el oxígeno atmosférico, en la imagen representadas por el color rojo. Hubo algunas bacterias anaerobias que fueron parasitadas por un tipo de bacterias Gram negativas. Con el tiempo, esta relación se hizo estable y se acabó formando una relación de mutua dependencia que derivó en la aparición de las células eucariotas.

En la célula eucariota, el tipo de célula de los humanos, también se puede hacer arqueología evolutiva. Por ejemplo, la glucolisis anaerobia tiene lugar en el citoplasma de la célula, mientras que el ciclo de Krebs y la fosforilación oxidativa tienen lugar en la mitocondria. La mayor parte de los genes de la bacteria aerobia de la que procede la mitocondria se perdió o se transfirieron al núcleo. El investigador gallego Antón Vila-Sanjurjo intentó, de forma muy valiente y arriesgada, dotar a la mitocondria de los genes necesarios para que llevase una vida independiente. La mitocondria está ya tan adaptada a la vida en el interior de la célula eucariota que fue incapaz de lograr su objetivo. Una nota curiosa para los frikis: Es interesante la ARN polimerasa de la mitocondria que no tiene que ver con las ARN polimerasa de bacterias ni de las células eucariotas, ambas compuestas de múltiples subunidades. La ARN polimerasa de la mitocondria es similar a la de los bacteriófagos.

La cooperación es "Quid pro quo" no paz y amor

El ser humano tiende a pensar de manera dual: Dios vs Satán, Sol y Luna, Caliente frío. Lo contrario de la competencia es la cooperación. Pensar esto último es un sesgo cultural. Ser competitivo no es ser un cabrón y ser cooperante es ser un hippie o un santo. En la cooperación existen unas reglas muy estrictas que cumplir. Estamos empezando a liberarnos de prejuicios y a entender las reglas del juego. Varios autores están mostrando que las relaciones entre las especies suelen ser competitivas. Para llegar a una simbiosis se dan varios pasos. Uno de los primeros es el parasitismo. Una vez que no puedes zafarte del parásito, comienza una aventura juntos, una aventura en la que ambas partes se vigilan para comprobar que la otra cumple la parte del trato. El último paso, como hemos visto en el caso de la mitocondria, consiste en centralizar toda la información genética en un núcleo común.

Vamos a ver varios casos para comprender este proceso. Una simbiosis actual son los líquenes, que son la asociación de un liquen con una cianobacteria. Si una piedra con un liquen la ponemos boca abajo de manera que no le de el sol, entonces el hongo se comerá a la cianobacteria porque al quedarse sin el alimento que le da la cianobacteria se la come. Si la piedra la metemos en un cubo con agua, el hongo se ahogará al no tener oxígeno y la cianobacteria no porque es capaz de producir O2 a partir de CO2 y H20. Son, al fin y al cabo organismos independientes. Por tanto, un líquen parece una especie vegetal cuando es un consorcio en el que una cianobacteria y un hongo están unidos y crean una estructura característica siempre y cuando se mantengan las condiciones y la relación entre ambos se respete.

Cuando una arqueobacteria se asoció con una bacteria Gram negativa, al principio eran una simbiosis. Finalmente, la mayoría de los genes, no todos, de la bacteria migraron y se fusionaron con el genoma de la arqueobacteria. La membrana plasmática de la arqueobacteria se invaginó y creó una membrana nuclear en donde se confinó. En ese momento se puede decir que aparece la primera célula con núcleo verdadero: la célula eucariota.

Cautivos del mal

En la película "Cautivos del mal" de Vicente Minelli, y guión de Charles Schnee, el personaje del productor Shields es un manipulador sin escrúpulos para quien lo esencial es el producto artístico final, tal como él lo concibe, aunque para conseguirlo deba apropiarse de ideas ajenas y rechazar la participación del que parecía su mejor amigo, enamorar a una actriz con la autoestima baja y demasiado pendiente de la botella o alejar (con desastrosas consecuencias) a la entrometida esposa de su exitoso guionista. A pesar del resentimiento frente a Shields tanto el director, como la actriz o el guionistas reconocen que nunca hubiesen alcanzado la fama si no hubiese sido por las malas artes del productor.En la película "Cautivos del mal" de Vicente Minelli, y guión de Charles Schnee, el personaje del productor Shields es un manipulador sin escrúpulos para quien lo esencial es el producto artístico final, tal como él lo concibe, aunque para conseguirlo deba apropiarse de ideas ajenas y rechazar la participación del que parecía su mejor amigo, enamorar a una actriz con la autoestima baja y demasiado pendiente de la botella o alejar (con desastrosas consecuencias) a la entrometida esposa de su exitoso guionista. A pesar del resentimiento frente a Shields tanto el director, como la actriz o el guionistas reconocen que nunca hubiesen alcanzado la fama si no hubiese sido por las malas artes del productor.

Lo que no te mata te hace más fuerte: la viruela dio una ventaja competitiva a los europeos

La viruela y el sarampión fueron una ventaja evolutiva que permitió el éxito y la expansión europea en América. Según el antropólogo Jared Diamond, Pizarro contó con una ayuda microscópica en la batalla de Cajamarca contra fuerzas incas que los superaban en un ratio de 1:50. Según publica en su libro "Gérmenes, armas y acero" el sarampión y la viruela ya habían causado pánico y estragos en la población previamente a la batalla.

¿Por qué los incas eran tan susceptibles a la viruela? La viruela originalmente es un virus de vaca. Cuando las poblaciones de Eurasia comenzaron a domesticar la vaca, el virus comenzó a infectar a las poblaciones humanas. La mayor parte de los europeos que llegaron a América tuvieron los virus en la etapa infantil y pudieron pasar las viriasis en esa etapa, por lo que ya disponían de inmunidad natural protectora. En el caso de los indígenas, la falta de contacto previo supuso una ‘virginidad inmunológica’, una falta de respuesta defensiva frente a las nuevas infecciones y por eso, al infectarse de adultos la mortalidad era tan alta.

Los virus le dan una ventaja competitiva a Pseudomonas aeruginosa

Pseudomonas en principio era una bacteria medioambiental. Vive en todo tipo de lugares, desde piscinas y spas hasta en el jabón desinfectante de hospitales. Por su extraordinaria capacidad metabólica pudo crecer en los ambientes limpios de los hospitales. Al ser los hospitales ambientes en los que los antibióticos están siempre presentes, con el tiempo se seleccionaron cepas resistentes a los antibióticos. Hoy en día, esta bacteria es la principal responsable de las infecciones adquiridas en los hospitales. Recientemente hemos aprendido de que, lo mismo que Pizarro se benefició de su historia evolutiva previa, Pseudomonas también se beneficia de un bacteriófago que antiguamente la parasitaba. Este virus bacteriofago (fago) engaña al sistema inmunitario para que este ignore a la bacteria.


Con los fagos ocurre lo mismo que con el virus del herpes labial que vive insertado en el ADN de nuestras neuronas. Sólo cuando detectan que su hospedador está estresado es cuando deciden salir de la célula que lo alberga. En el caso de los fagos rompiendo desde dentro a la bacteria, en el caso de las neuronas viajando desde el núcleo de la neurona por todo el axón hasta llegar a las células del labio en donde causa un sarpullido lleno de virus que le permite transmitirse a otro hospedador por un beso, un vaso compartido etc.
Video 2: Diferencia entre fagos líticos (los que destruyen a las bacterias) y los lisogénicos (que pueden insertar temporalmente su ADN en el ADN de la bacteria hospedadora). Fuente

La bacteria y el fago, llamado Pf, establecen una relación de simbiosis que se sospecha que está más extendida en el mundo microbiano de lo que se creía. Pseudomonas crece en las heridas abiertas de los pacientes de los hospitales. Las Pseudomonas que no tienen en su interior fagos sobreviven menos que aquellas Pseudomonas que si los tienen porque cuando el fago detecta que el sistema inmune ataca a Pseudomonas sale de entre el ADN de la bacteria, hace muchas copias de si mismo, mata a la bacteria y sale por decenas al cuerpo del paciente. Esto hace que el sistema inmunitario se dedique a matar fagos dándole un respiro a las bacterias que pueden seguir colonizando la herida abierta aunque tengan que pagar el peaje de que muchas de ellas revienten por culpa de la proliferación de los fagos. a ir tras él en lugar de hacerlo tras su hospedador. Este hallazgo ha sido publicado el pasado 28 de marzo en Science y ayudaría a explicar por qué el sistema inmunitario tolera las bacterias beneficiosas, como las presentes en el intestino, y podría guiar el diseño de mejores tratamientos para las infecciones.

Heridas abiertas infectadas por bacterias cautivas del mal

Para comprobar si los fagos influyen en el modo en el que las bacterias interactúan con sus huéspedes, el inmunólogo Paul Bollyky, de la Universidad Stanford, recogió muestras de heridas crónicas, como quemaduras infectadas, de 111 personas. De estas muestras, 37 presentaban infección por P. aeruginosa.

Bollyky y sus colaboradores encontraron que el 68 por ciento de las heridas que contenían P. aeruginosa albergaban también el virus Pf. Cuando transfirieron estas bacterias infectadas por el fago a heridas abiertas de ratones, descubrieron que el número de bacterias necesario para iniciar la infección en los roedores era menor y que estos eran más propensos a morir a causa de esas heridas que cuando eran infectados únicamente con la bacteria P. aeruginosa.
Fig. 4. Internalización del fago Pf en una célula de mamífero. La endocitosis de Pf por las células dendríticas y otros leucocitos dispara los receptores de reconocimiento viral, los cuales suprimen la limpieza y eliminación de las bacterias. Esta imagen tridimensional fue generada utilizando microscopía confocal y imágenes apiladas en Z. Púrpura tiñe las fibras de actina, azul el ADN mediante DAPI, el verde es el fluoróforo Alexa Fluor 488 unido a un anticuerpo antiPf4. Fuente

Las bacterias atraían a unas células del sistema inmunitario llamadas fagocitos, los cuales «engullen» a las bacterias pero no a los virus. Los fagocitos intervenían en las heridas infectadas por P. aeuruginosa y Pf y se marchaban poco después de haber engullido unas pocas bacterias. Luego envíaban señales que atraín a otras células del sistema inmunitario encargadas de atacar solo a los virus del área.
Fig. 5. Se logró reducir las infecciones causadas por P. aeuruginosa mediante la vacunación de los ratones contra los Pf, antes de infectarlos con la combinación de bacteria y virus.

Endosimbiosis en marcha y por doquier

Prometheoarchaeum syntrophicum cepa MK-D1 es una arqueobacteria del grupo Asgard. Un grupo de científicos japoneses, después de 12 años de intentarlo, han conseguido aislarla de los sedimentos marinos y cultivarla en laboratorio, lo cual abre las puertas a la experimentación científica. ¿Por qué es tan interesante esta bacteria? porque crece mejor si está en asociación con otras bacterias. Además, forma tentáculos con los que puede atrapar a las bacterias que se volverán sus compañeras, formando así relaciones simbióticas con ellas.

Si tenemos un modelo bacteriano de simbiosis podremos empezar a hacerles preguntas. Es una pena porque ya han existido modelos semejantes, por ejemplo el de las amebas y la bacteria X del científico surcoreano Jeon. En este modelo se puede observar cómo las bacterias X y las amebas acaban formando una simbiosis perfecta, en donde las bacterias necesitan a la ameba pero la ameba no puede vivir sin ellas. En este blog ya le dediqué una entrada.

Gemmata obscuriglobus de las arqueobacterias a las eubacterias Gram negativas

Bacterias que nos enseñan que la teoría endosimbiótica de Lynn Margulis está en lo cierto existen algunas, como Gemmata obscuriglobus. Esta bacteria es una Gram negativa pero que carece de péptidoglicano. Una especie de eslabón perdido. Sería algo así como el paso de las arqueobacterias a las Gram negativas.

Esta bacteria es muy interesante porque al no tener peptidoglicano no tiene una presión interna elevada y su membrana crea compartimentos similares a los que tiene la célula eucariota. De hecho se cree que las invaginaciones de la membrana plasmática de esta bacteria serían como un preambulo del núcleo celular.

Célula endosimbionte en su proceso de convertirse en una organela celular

En el interior de la ameba de agua dulce Paulinella chromatophora vive lo que sería una célula endosimbionte en su proceso de convertirse en una organela celular. En el interior de Paulinella viven una o dos células endosimbiontes fotosintéticas que se asemejan a las cianobacterias. El genoma de este endosimbionte es considerable, 1 Mb (un millón de bases), lo que es pequeño para una cianobacteria de vida libre pero enorme para un cloroplasto. Este genoma no tiene nada que ver con los genomas de las β-cianobacterias que son las precursoras de los cloroplastos de las plantas. En realidad está emparentado con otro grupo de bacterias fotosintéticas: las Prochlorococcus/Synechococcus pertenecientes a las α-cianobacterias. Este dato es muy interesante porque subraya la idea de que los cloroplastos surgieron en la evolución en varios momentos de manera independiente.

Fig. 6. Paulinella chromatophora con cromatóforos. Photo Eva Nowack

Otro de las particularidades de este sistema endosimbiótico es que genes de este simbionte, genes que codifican proteínas del sistema fotosintético, se han transferido al núcleo de Paulinella. Este tipo de migraciones de genes de la organela al núcleo del hospedador es algo común en los organelas simbióticas como las mitocondrias o los cloroplastos pero no es frecuente observarlo en organismos simbiontes. Lo que tampoco es habitual es que el endosimbionte de Paulinella mantiene todos los componentes necesarios para que su cromosoma replique autonomamente.

El origen de replicación oriC is completamente idéntico a los de Prochlorococcus. Por lo tanto estamos delante de un organismo en el que se están dando los pasos para que un endosimbionte se convierta en una organela celular. Si entendemos como ocurre la transferencia de sus genes al núcleo y también cómo se sincroniza la replicación del cromosoma del simbionte con la de su hospedador podremos entender qué es lo que hace falta para que una célula simbionte se convierta en un orgánulo celular. Lo interesante del caso es que hasta ahora se suponía que algo semejante había ocurrido hace mucho mucho tiempo, cuando surgió las primeras células eucariotas y las células eucariotas que dieron lugar a las algas y a las plantas. Ahora, gracias a Paulinella, podemos tener a un evento evolutivo remoto desarrollarse ante nuestros ojos

Bibliografía: 

https://www.nature.com/articles/d41586-019-00991-4
https://science.sciencemag.org/content/363/6434/eaat9691
https://www.investigacionyciencia.es/noticias/algunos-virus-bacterifagos-engaan-al-sistema-inmunitario-para-que-no-ataque-a-las-bacterias-17386
Zhang Wang, Martin Wu Phylogenomic Reconstrucción Indica mitocondrial antepasado fue una Energía Parásito . PLOS ONE , 2014 DOI: 10.1371 / journal.pone.0110685

viernes, 6 de mayo de 2022

Si el microbioma aumenta tu prolina entonces te deprimes

La prolina es un aminoácido que se está popularizando entre corredores. Las páginas especializadas se hacen eco de los beneficios de consumir alimentos ricos en prolina como son el pollo, pavo, cerdo, ternera y lospescados: Sardina, mero, salmón, y atún. También los lacteos y las judías, guisantes, zanahorias o pepino...

La prolina es una aminoácido no esencial, es decir, que no hace falta consumirlo en la dieta. Nuestro cuerpo puede fabricarlo a partir de otros alimentos.

Los beneficios de un consumo de alimentos ricos en prolina son: Incrementa el nivel de colágeno; protege el sistema cardiovascular; recuperación muscular, tratamiento de patologías como la artritis/artrosis. Un estudio publicado en Cell Metabolism recientemente muestra que cambios en el microbiota pueden aumentar los niveles de prolina en sangre y este aumento correlaciona con depresión. En el estudio, no todo el mundo que tenía un alto consumo de prolina manifestaba encontrarse con depresión, por ese motivo, los investigadore utilizaron estudios en animales. 

El microbiota que aumenta la prolina lo logra en diferentes especies de animales, y todos se deprimen

Para saber si la presencia de prolina era causa o consecuencia del ánimo depresivo, se trasplantó la microbiota de los participantes a ratones. Los roedores que se deprimían más eran los que recibían la microbiota de participantes con una alta prolina, o de personas con más ánimo depresivo. En el cerebro de estos ratones también se encontraron diferentes genes asociados al transporte de prolina.

Otro experimento de confirmación se hizo utilizando moscas de la fruta (Drosophila melanogaster), en las cuales se puede inducir un estado de ánimo más depresivo. Los investigadores aislaron dos tipos de bacterias de la microbiota asociadas al consumo de prolina y las añadieron a la alimentación esterilizada de las moscas. Las moscas que ingerían alimentación con Lactobacillus, que en los ratones se asociaba a menos depresión, demostraron tener más ganas de superar dificultades a que se enfrentaban después. En cambio, las que ingerían Enterobacter, que en humanos se asocia a la depresión, se deprimían mucho más.

Cuándo se estudió la microbiota intestinal de estas personas, también se observó una relación entre la depresión y las bacterias, así como entre la depresión y genes bacterianos asociados al metabolismo de la prolina. Así, se observó que los niveles de prolina circulante dependían de la microbiota.


viernes, 29 de abril de 2022

Aparece el oxígeno atmosférico y el mundo se divide en dos

Se asume que el primer ribozima del cual procede toda la vida de la Tierra, un organismo hipotético al que se le conoce como Luca, por la sigla en inglés de “último ancestro común universal” (Last Universal Common Ancestor), y se calcula que vivió hace aproximadamente 4000 millones de años, cuando la Tierra tenía apenas 560 millones de años de edad. 400 años después de la aparición de esta forma de vida surgen unas bacterias con capacidad de realizar fotosíntesis anoxigénica, es decir, sin presencia del oxígeno. Este tipo de fotosíntesis tenía lugar en presencia de ácido sulfhídrico (H2S) liberándo azufre molecular en el proceso (S2). También podrían usar arsénico o hidrógeno como donadores de electrones. Tenemos que pensar que hacía solo un 1000 millones de años que se había formado la Tierra. La actividad volcánica era elevada y las bacterias que poblaban el planeta eran similares a las que hoy consideramos extremófilas. Bacterias que viven en fumarolas de agua hirviendo, dentro de hielo a -120ºC, aguas ácidas, lagunas hipersalinas, costras del desierto.  Una de estas bacterias con capacidad de realizar la fotosíntesis, a las que a partir de ahora llamaremos cianobacterias, fueron capaces de realizar una variante de la fotosíntesis que ha llegado a ser la predominante en todo nuestro planeta. Se trata de la fotosíntesis oxigénica. La fotosíntesis necesita un reductor (una fuente de electrones), que en este caso es el agua (H2O). Al tomar el H del agua se libera oxígeno.                                                      

                                                                    Luz solar

                                               6 H2O + 6CO2  ------------>   6O2 + Glucosa

Fig. 1: Reacción química de la fotosíntesis

Esta reacción tuvo tanto éxito porque partía de dos elementros muy abundantes en la Tierra: luz solar, agua y CO2 . La explosión evolutiva y ecológica de las cianobacterias hizo que éstas cubriesen todos los mares, lagos y superficies terrestres. Hace 2500 millones de años se alcanzó unas concentraciones de oxígeno similares a las que tenemos actualmente, en donde el 21% de la atmósfera que respiramos es O2

Recapitulando, básicamente si la vida tiene 4000 años sobre la Tierra, hasta alcanzar el nivel de oxígeno actual, el planeta estuvo 1500 millones de años y los 2500 millones de años hasta la actualidad con un planeta dividido en dos: el mundo sin oxígeno, también llamado anaerobio y el mundo aerobio. 

Los seres humanos también seguimos ese patrón: somos organismos aerobios y anaerobios. Pensamos que somos exclusivamente aerobios porque necesitamos respirar. Tomamos aire con oxígeno con nuestros pulmones y exhalamos CO2. No obstante, tenemos partes de nuestro cuerpo que carecen de oxígeno. Sin ir más lejos, nuestros intestinos son anaerobios. No exhalan CO2, exhalan metano. Los intestinos exhalan por donde la espalda pierde su casto nombre. Existen más lugares carentes de oxígeno. Por ejemplo las cavidades recónditas, como el surco gingival en donde se insertan los dientes. Allí viven bacterias como Streptococcus mutans, la causante de las caries o Porphyromonas gingivales, la sospechosa de causar Alzheimer en humanos.

A nivel planetario, el oxígeno se concentró en la atmósfera y en las capas superficiales de océanos, ríos y lagos. En las profundidades de los mismos, en el interior de la superfice terrestre... esos lugares siguieron siendo anaerobio, y allí donde nosotros no podemos vivir viven todavía las arqueobacterias anaerobias que reinaron en el planeta durante 1500 millones de años. 

Durante esos 1500 millones de años, las arqueobacterias desarrollaron todo tipo de rutas metabólicas. Donde nosotros respiramos oxígeno y oxidamos básicamente los azúcares que comemos, ellas oxidaban compuestos que son extremadamente tóxicos para nosotros como el ácido sulfhídrico (H2S), que son compuestos inorgánicos. Se podría decir que si nosotros quemamos azúcares, ellas quemaban piedras. El metabolismo de los organismos aerobios es similar en todos nosotros. El famoso ciclo de Krebs que se estudia en bioquímica I. En cambio las arqueobacterias exhiben distintos tipos de rutas metabólicas. Es algo que podemos visualizar mediante la Columna de Winogradsky.

Una columna para tenerlos a todos

Con el experimento de la Columna de Winogradsky podemos visualizar fácilmente como el mundo se divide en dos: aerobio, en presencia de oxígeno y anaerobio en ausencia de él. Las condiciones anóxicas surgen a tan sólo unos pocos milímetros de la superficie. Debido a esta deficiencia de oxígeno, aquellos organismos que habitan estos ambientes deben ser capaces de sobrevivir respirando compuestos distintos del O2. En este caso, los microorganismos anaerobios pueden respirar aceptores de electrones como el nitrato, hierro férrico (III), óxido de manganeso (IV), sulfato y dióxido de carbono para producir biomasa y la energía que ellos consumen. 

Fig. 2. En el experimento clásico de la columna de Winogradsky en el fondo de la columna se le añade papel de periódico como fuente de hidratos de carbono, la glucosa presente en la celulosa del papel y un huevo que proporcionará el azufre. A esa mezcla de azucar y proteínas se le añade sedimentos de una charca, estero o laguna. Se cubre de agua. A la izquierda se puede observar los sedimentos según se le han añadido a la columna. A la derecha, dos meses después de haber empezado el experimento se observan los distintos estratos de bacterias que están respirando en ausencia de oxígeno el azucar y el huevo que se encuentran en la base.

 Fig. 3. Las relaciones que se establecen entre los distintos modos de “alimentación” microbiana constituyen ecosistemas complejos pero se pueden observar, de forma sencilla, con una columna Winogradsky. Fuente

Cardio y pesas

Todos los que hemos ido a un gimnasio sabemos que tienen dos partes diferenciadas: la de los ejercicios de cardio y las pesas. Esa división tiene que ver también con esta división del mundo anaerobio y el mundo aerobio. El metabolismo energético de la célula humana, de una célula eucariota, con núcleo y organelas, está dividido en dos rutas, una ruta anaerobia, sin oxígeno, en la se rompe la molécula de azucar en dos moléculas de acetil-CoA y otra ruta aerobia que comprende el ciclo de Krebs y la fosforilación oxidativa fosforila. Estas dos reacciones degradan el acetil-CoA hasta HOy CO

La ruta anaerobia es una ruta rápida y genera por cada molécula de azucar dos ATPs. Esta molécula, el ATP, es  como vamos a ver el dolar de todas las transacciones energéticas de la célula. La ruta aerobia, toma el acetil-CoA y lo degrada a dos moléculas muy pobres energéticamente, , y libera 30 ATPs. Mucho más eficiente energéticamente. Sin embargo, esta ruta es más lenta que la ruta anaerobia.

La rapidez e inmediatez es lo que buscamos cuando levantamos pesas, por eso usamos el metabolismo anaerobio. Cuando queremos obtener energía y al mismo tiempo hacer un ejercicio durante mucho tiempo, el típico ejercicio de cardio, usamos el metabolismo aerobio. 

El ATP es la moneda energética de la célula

Es por así decirlo la gasolina que mueve todas las reacciones enzimáticas en la célula. En nuestras gasolineras existe dos tipos de combustibles: la gasolina y el diesel. En las células, tanto bacterianas como en las eucarióticas (las de humanos, plantas, hongos y protozoos), se usa básicamente el ATP. La molécula está compuesta de una base nitrogenada, la adenina, unida a un azucar, la ribosa, a la ribosa se le unen tres fosfatos inorgánicos. Que la adenina esté unida a una ribosa es otro ejemplo que apoya la teoría que dice que el primer ácido nucleico que soportó la vida fue el ARN y no el ADN como ocurre hoy en día en la mayoría de los organismos, excepto en los virus de tipo ARN.
Fig. 4. La molécula de ATP, en la imagen, tiene átomos con carga negativa, como son los oxígenos representados con estas esferas rojas. Está muy próximos entre si, se mantienen unidos al límite del enlace que los mantiene juntos. A poco que esta molécula se modifique el fósforo, en dorado, unido a los oxígenos, en rojo, del extremo izquierdo se van a desprender. Ese movimiento de repulsión es lo que va a mover todos los procesos que necesitan energía en la célula.

Los tres fosfatos inorgánicos son moléculas cargadas negativamente, y están unos al lado de los otros. ¿Habéis intentado alguna vez unir dos imanes por polos semejantes? los imanes se repelen y hace falta mucha fuerza para juntarlos. Eso es lo que ocurre con los tres fosfatos inorgánicos. Están unidos covalentemente pero se repelen y cuando el enlace covalente se rompe el fosfato saliente sale repelido y ese movimiento de repulsión hace mover todas las máquinas enzimáticas de la célula.Una de las acepciones de la Real Academia de la Lengua Española sobre la palabra "parsimonia": Frugalidad y moderación en los gastos. Esta es una caracteristica de los seres vivos. Cuando algo funciona no se cambia. ¿Cómo se va a seleccionar mejoras en algo que ya es inmejorable? esto es lo que le ocurre a moléculas como el ATP. Su estructura es igual en cualquier organismo que miremos.

Ahora que sabemos que tanto el metabolismo anaerobio y el aerobio sirven para que la célula posea esta molécula energética, surge la siguentes dudas: ¿Por qué tenemos dos tipos de metabolismo? ¿Por qué si somos seres que respiramos oxígeno tenemos un metabolismo anaerobio que no utiliza oxígeno? Lo veremos en el siguiente capítulo

martes, 26 de abril de 2022

¿Qué fue de Excálibur? el perro sacrificado por sospecha de ébola

En 2014, el gobierno español repatrió a un misionero que había contraído el ébola en África. Se entiende la acción como un gesto humanitario. El problema es que supuso traer a un paciente 0 al país, trayendo consigo a un virus altamente contagioso cuando no tenían infraestructuras para tratarlo. Se produjo un circo mediático protestando sobre la improvisación del gobierno. Una enfermera se contagió de ébola y afortunadamente lograron salvarle la vida. No así al perro de la enfermera, Excalibur, que fue sacrificado en prevención. La enfermera pidió una indemnización. En 2022 ya tenemos resolución judicial.

Excalibur, el perro de la sanitaria Teresa Romero, sacrificado sin pruebas científicas de manera preventiva.

Condenada la sanitaria del ébola a 2.100 euros por denunciar el sacrificio de su perro. Titular excesivo: Más que condenada, tiene que pagar las costas de una denuncia que puso ella reclamando 150000 euros por daños morales.


¿Qué significó la pandemia para usted?

En 2003, en los seminarios del Departamento de Patogénesis Microbiana de la Universidad de Míchigan, en donde era investigador postdoctoral, los grupos de investigación que desarrollaban modelos matemáticos auguraban una próxima pandemia sobre el año 2015. Al final, la pandemia fue detectada en 2019, de ahí el nombre Covid-19. Esos mismos grupos, por 2003-2006, auguraban una pandemia posterior mucho más agresiva, que no tendría un origen natural, como la del Covid-19, sino un origen militar, probablemente producto de un ataque terrorista. Estamos esperando por esa nueva pandemia. La pandemia significó darme cuenta de qué significa el hecho de que las predicciones se pueden cumplir. Significó conocer qué significa una letalidad, la del SARS-CoV-2, de 0.5-1% cuando mi suegro, José Alberto Ramírez, falleció de Covid-19 en Caracas. ¡Qué vacío se sintió con su pérdida!.
Durante la pandemia y el confinamiento, ahorré tiempo. Lo aproveché para escribir y reflexionar sobre mi madre, fallecida en 2016, sobre mis hijos y lo que supone el alejamiento, la pérdida. ¡Qué fructífero fue reflexionar sobre lo que realmente es importante! sobre la cantidad de ruido que tenemos en nuestras vidas que no nos deja percibir lo que amamos. Entre 2021 y 2022 publicamos 5 artículos sobre esta pandemia. Esta pandemia no se ha acabado. Vendrán otras. Debemos reflexionar, prepararnos para minimizar en lo posible el daño y el sufrimiento, ahora que sabemos que las predicciones se pueden cumplir.

Bibliografía generada:

Biomarkers of severe COVID-19 pneumonia on admission using data-mining powered by common laboratory blood tests-datasets. Pulgar-Sánchez M, Chamorro K, Fors M, Mora FX, Ramírez H, Fernandez-Moreira E, Ballaz SJ. Comput Biol Med. 2021 Sep;136:104738. doi: 10.1016/j.compbiomed.2021.104738. Epub 2021 Aug 8.

Common laboratory tests as indicators of COVID-19 severity on admission at high altitude: a single-center retrospective study in Quito (ECUADOR). Ballaz SJ, Pulgar-Sánchez M, Chamorro K, Fernández-Moreira E, Ramírez H, Mora FX, Fors M. Clin Chem Lab Med. 2021 Mar 5;59(8):e326-e329. doi: 10.1515/cclm-2021-0156. Print 2021 Jul 27.

A Cross-Sectional Study to Assess Knowledge of COVID-19 among Undergraduate Students in North-Central Ecuador. Ortega-Paredes D, Larrea-Álvarez CM, Jijón SI, Loaiza K, Šefcová MA, Molina-Cuasapaz G, Barba P, Vinueza-Burgos C, Fernandez-Moreira E, Ramírez H, Larrea-Álvarez M.
Int J Environ Res Public Health. 2021 Aug 18;18(16):8706. doi: 10.3390/ijerph18168706.

An On-Line Cross-Sectional Questionnaire to Assess Knowledge of COVID-19 Pandemic among Citizens Tested for the SARS-CoV-2 Virus in Quito and Ibarra, Ecuador. Ortega-Paredes D, Zurita J, Zurita C, Leoro-Garzón P, Leoro-Monroy G, Larrea-Álvarez CM, Loaiza K, Fernandez-Moreira E, Molina-Cuasapaz G, Larrea-Álvarez M. Int J Environ Res Public Health. 2021 Feb 10;18(4):1691. doi: 10.3390/ijerph18041691.

Sex-Dependent Performance of the Neutrophil-to-Lymphocyte, Monocyte-to-Lymphocyte, Platelet-to-Lymphocyte and Mean Platelet Volume-to-Platelet Ratios in Discriminating COVID-19 Severity.
Fors M, Ballaz S, Ramírez H, Mora FX, Pulgar-Sánchez M, Chamorro K, Fernández-Moreira E.
Front Cardiovasc Med. 2022 Apr 8;9:822556. doi: 10.3389/fcvm.2022.822556. eCollection 2022.

jueves, 21 de abril de 2022

Cáncer de próstata y bacterias

 El estudio del microbioma de más de 600 pacientes con y sin cáncer de próstata agresivo reveló 4 nuevas bacterias presentes en los pacientes con cáncer de próstata agresivo y ausente en los pacientes sanos. Se identificaron  cuatro nuevas bacterias: Porphyromonas sp. nov., Varibaculum sp. nov., Peptoniphilus sp. nov. y Fenollaria sp.

Se nombró a la Porphyromonas como Porphyromonas bobii, y a la nueva especie de Varibaculum  Varibaculum prostatecancerukia,


Para saber más: 
 
Microbiomes of Urine and the Prostate Are Linked to Human Prostate Cancer Risk Groups. Rachel Hurst, R. et al. (2022) DOI:https://doi.org/10.1016/j.euo.2022.03.006

jueves, 14 de abril de 2022

Ya no eres tu, ahora eres yo

Dedicada a mi hija Flavia que me recomendó el video

Las tres relaciones básicas entre tú y los demás se pueden resumir en este gráfico:

Fig. 1. El territorio representado por el círculo puede ser equivalente a una célula o un individuo. En el primer caso, competición, si tu territorio está ocupado por él entonces es que te han comido o te han eliminado de tu territorio. En la simbiosis, ambos prevalecen en el mismo territorio. En el caso del parasitismo, el parásito es aquel que ocupa parte de tu territorio. 

Respecto al parasitismo, la frase que mejor ilustra la relación entre el yo y el parásito es la canción de Héctor Lavoe "¡Quítate tu pa´ ponerme yo!". Cymothoa exigua es un crustáceo que devora la lengua de los peces para vivir en ese espacio. Como el pez tiene que tragar y necesita la lengua, C. exigua hace las funciones de la lengua empujando el bolo alimenticio garganta abajo. 

Elysia marginata pierde la cabeza para desembarazarse de parásitos, como se puede ver en el video 1. Este comportamiento interesante. De alguna manera, la cabeza prevalece sobre el cuerpo que está infestado de parásitos. Lo que hace Elysia marginata es autotomizarse, es decir, separar la cabeza del cuerpo, para liberar a la cabeza del cuerpo parasitado. Elysia marginata, como otras especies de Elysias puede vivir sin sistema digestivo por que es capaz de robar los cloroplastos de las algas de las que se alimenta y exponerlas bajo su piel. Un robo de cloroplastos que se llama cleptoplastia, una especie de endosimbiosis.

Video 1. Esto Es Lo Que Todas Las Mantis Temen. Min. 4:40 Elysia marginata. Fuente WATOP

Lo que ocurre con la autotomización del cuerpo de Elysia marginata se podría representar de la siguiente manera: 

En el video se ve que realmente la autotomización elimina el 80% del cuerpo de E. marginata. Debe de compensarle cuando lo hace. A esta especie la simbiosis le parece bien, la competición también. Lo que no le gusta es el parasitismo. Este gesto indica, de alguna manera, una autopercepción de E. marginata. En 2018 hice una entrada sobre este tema: ¡Qué bien se vive sin parásitos!

En el video también se ve como muchos parásitos, como por ejemplo, los nematomorfos, o  Toxoplasma gondii, controlan la mente de los parasitados. Es fácil, al fin y al cabo no hay más que controlar principios básicos, a nivel neuronal, y esto hace del parasitado un zombie que trabaja para el parásito. Un poco lo que hacen los líderes de las sectas destructivas. Hay un conflicto entre yo y el. ¿Cómo me protejo de él? desarrollando sistemas inmunes. ¿Cómo él se protege de mi? pues manipulándome, haciéndome creer que yo soy él, que lo que me interesa es lo que él me propone. 

Thomas Hobbes, el pensador inglés del S XVII que fundó la filosofía política moderna, estableció que por interés propio las personas realizaban pactos con otras personas. Obviamente, estos pactos crean obligaciones que tenemos que cumplir. No vale el excusarnos en el interés propio cuando hemos firmado un pacto, o un juez ha establecido un pacto entre dos partes en litigio. Ser parte de una comunidad y aceptar sus beneficios implica la aceptación de la norma. Pero... hay individuos que por interés propio intentan no responsabilizarse de los pactos. Greg Velicer (Velicer et al, 2000) postuló que en una población homogénea de la bacteria social Myxococcus xanthus existen dos clases de individuos: los altruístas y los engañadores. Los que engañan suelen tener más fácil vivir a expensas de los otros.

Los psicópatas, perversos narcisistas y manipuladores también llevan una vida parasitaria. Viven de los recursos de los demás. Es habitual que en poco tiempo de conocerte se instalen en tu casa y pretendan no participar a medias en los gastos. La responsabilidad de cuidar a otras les queda grande. La irresponsabilidad es la que hace obligatoria la vida parasitaria: buscar a alguien que le aporte lo que ellos no pueden conseguir o simplemente no quieren hacerlo. Si tenemos cabeza, como Elysia marginata, debemos desprendernos de los parásitos para volver a ser nosotros mismos.

Bibliografía:

Velicer, G., Kroos, L. & Lenski, R. Developmental cheating in the social bacterium Myxococcus xanthus . Nature 404, 598–601 (2000). https://doi.org/10.1038/35007066

Para saber más:

Cymothoa exigua: quítate tu pa ponerme yo

Los cloroplastos y Elysia chlorotica

Elysia viridis o la importancia de ser simbiótica