viernes, 29 de abril de 2022

Aparece el oxígeno atmosférico y el mundo se divide en dos

Se asume que el primer ribozima del cual procede toda la vida de la Tierra, un organismo hipotético al que se le conoce como Luca, por la sigla en inglés de “último ancestro común universal” (Last Universal Common Ancestor), y se calcula que vivió hace aproximadamente 4000 millones de años, cuando la Tierra tenía apenas 560 millones de años de edad. 400 años después de la aparición de esta forma de vida surgen unas bacterias con capacidad de realizar fotosíntesis anoxigénica, es decir, sin presencia del oxígeno. Este tipo de fotosíntesis tenía lugar en presencia de ácido sulfhídrico (H2S) liberándo azufre molecular en el proceso (S2). También podrían usar arsénico o hidrógeno como donadores de electrones. Tenemos que pensar que hacía solo un 1000 millones de años que se había formado la Tierra. La actividad volcánica era elevada y las bacterias que poblaban el planeta eran similares a las que hoy consideramos extremófilas. Bacterias que viven en fumarolas de agua hirviendo, dentro de hielo a -120ºC, aguas ácidas, lagunas hipersalinas, costras del desierto.  Una de estas bacterias con capacidad de realizar la fotosíntesis, a las que a partir de ahora llamaremos cianobacterias, fueron capaces de realizar una variante de la fotosíntesis que ha llegado a ser la predominante en todo nuestro planeta. Se trata de la fotosíntesis oxigénica. La fotosíntesis necesita un reductor (una fuente de electrones), que en este caso es el agua (H2O). Al tomar el H del agua se libera oxígeno.                                                      

                                                                    Luz solar

                                               6 H2O + 6CO2  ------------>   6O2 + Glucosa

Fig. 1: Reacción química de la fotosíntesis

Esta reacción tuvo tanto éxito porque partía de dos elementros muy abundantes en la Tierra: luz solar, agua y CO2 . La explosión evolutiva y ecológica de las cianobacterias hizo que éstas cubriesen todos los mares, lagos y superficies terrestres. Hace 2500 millones de años se alcanzó unas concentraciones de oxígeno similares a las que tenemos actualmente, en donde el 21% de la atmósfera que respiramos es O2

Recapitulando, básicamente si la vida tiene 4000 años sobre la Tierra, hasta alcanzar el nivel de oxígeno actual, el planeta estuvo 1500 millones de años y los 2500 millones de años hasta la actualidad con un planeta dividido en dos: el mundo sin oxígeno, también llamado anaerobio y el mundo aerobio. 

Los seres humanos también seguimos ese patrón: somos organismos aerobios y anaerobios. Pensamos que somos exclusivamente aerobios porque necesitamos respirar. Tomamos aire con oxígeno con nuestros pulmones y exhalamos CO2. No obstante, tenemos partes de nuestro cuerpo que carecen de oxígeno. Sin ir más lejos, nuestros intestinos son anaerobios. No exhalan CO2, exhalan metano. Los intestinos exhalan por donde la espalda pierde su casto nombre. Existen más lugares carentes de oxígeno. Por ejemplo las cavidades recónditas, como el surco gingival en donde se insertan los dientes. Allí viven bacterias como Streptococcus mutans, la causante de las caries o Porphyromonas gingivales, la sospechosa de causar Alzheimer en humanos.

A nivel planetario, el oxígeno se concentró en la atmósfera y en las capas superficiales de océanos, ríos y lagos. En las profundidades de los mismos, en el interior de la superfice terrestre... esos lugares siguieron siendo anaerobio, y allí donde nosotros no podemos vivir viven todavía las arqueobacterias anaerobias que reinaron en el planeta durante 1500 millones de años. 

Durante esos 1500 millones de años, las arqueobacterias desarrollaron todo tipo de rutas metabólicas. Donde nosotros respiramos oxígeno y oxidamos básicamente los azúcares que comemos, ellas oxidaban compuestos que son extremadamente tóxicos para nosotros como el ácido sulfhídrico (H2S), que son compuestos inorgánicos. Se podría decir que si nosotros quemamos azúcares, ellas quemaban piedras. El metabolismo de los organismos aerobios es similar en todos nosotros. El famoso ciclo de Krebs que se estudia en bioquímica I. En cambio las arqueobacterias exhiben distintos tipos de rutas metabólicas. Es algo que podemos visualizar mediante la Columna de Winogradsky.

Una columna para tenerlos a todos

Con el experimento de la Columna de Winogradsky podemos visualizar fácilmente como el mundo se divide en dos: aerobio, en presencia de oxígeno y anaerobio en ausencia de él. Las condiciones anóxicas surgen a tan sólo unos pocos milímetros de la superficie. Debido a esta deficiencia de oxígeno, aquellos organismos que habitan estos ambientes deben ser capaces de sobrevivir respirando compuestos distintos del O2. En este caso, los microorganismos anaerobios pueden respirar aceptores de electrones como el nitrato, hierro férrico (III), óxido de manganeso (IV), sulfato y dióxido de carbono para producir biomasa y la energía que ellos consumen. 

Fig. 2. En el experimento clásico de la columna de Winogradsky en el fondo de la columna se le añade papel de periódico como fuente de hidratos de carbono, la glucosa presente en la celulosa del papel y un huevo que proporcionará el azufre. A esa mezcla de azucar y proteínas se le añade sedimentos de una charca, estero o laguna. Se cubre de agua. A la izquierda se puede observar los sedimentos según se le han añadido a la columna. A la derecha, dos meses después de haber empezado el experimento se observan los distintos estratos de bacterias que están respirando en ausencia de oxígeno el azucar y el huevo que se encuentran en la base.

 Fig. 3. Las relaciones que se establecen entre los distintos modos de “alimentación” microbiana constituyen ecosistemas complejos pero se pueden observar, de forma sencilla, con una columna Winogradsky. Fuente

Cardio y pesas

Todos los que hemos ido a un gimnasio sabemos que tienen dos partes diferenciadas: la de los ejercicios de cardio y las pesas. Esa división tiene que ver también con esta división del mundo anaerobio y el mundo aerobio. El metabolismo energético de la célula humana, de una célula eucariota, con núcleo y organelas, está dividido en dos rutas, una ruta anaerobia, sin oxígeno, en la se rompe la molécula de azucar en dos moléculas de acetil-CoA y otra ruta aerobia que comprende el ciclo de Krebs y la fosforilación oxidativa fosforila. Estas dos reacciones degradan el acetil-CoA hasta HOy CO

La ruta anaerobia es una ruta rápida y genera por cada molécula de azucar dos ATPs. Esta molécula, el ATP, es  como vamos a ver el dolar de todas las transacciones energéticas de la célula. La ruta aerobia, toma el acetil-CoA y lo degrada a dos moléculas muy pobres energéticamente, , y libera 30 ATPs. Mucho más eficiente energéticamente. Sin embargo, esta ruta es más lenta que la ruta anaerobia.

La rapidez e inmediatez es lo que buscamos cuando levantamos pesas, por eso usamos el metabolismo anaerobio. Cuando queremos obtener energía y al mismo tiempo hacer un ejercicio durante mucho tiempo, el típico ejercicio de cardio, usamos el metabolismo aerobio. 

El ATP es la moneda energética de la célula

Es por así decirlo la gasolina que mueve todas las reacciones enzimáticas en la célula. En nuestras gasolineras existe dos tipos de combustibles: la gasolina y el diesel. En las células, tanto bacterianas como en las eucarióticas (las de humanos, plantas, hongos y protozoos), se usa básicamente el ATP. La molécula está compuesta de una base nitrogenada, la adenina, unida a un azucar, la ribosa, a la ribosa se le unen tres fosfatos inorgánicos. Que la adenina esté unida a una ribosa es otro ejemplo que apoya la teoría que dice que el primer ácido nucleico que soportó la vida fue el ARN y no el ADN como ocurre hoy en día en la mayoría de los organismos, excepto en los virus de tipo ARN.
Fig. 4. La molécula de ATP, en la imagen, tiene átomos con carga negativa, como son los oxígenos representados con estas esferas rojas. Está muy próximos entre si, se mantienen unidos al límite del enlace que los mantiene juntos. A poco que esta molécula se modifique el fósforo, en dorado, unido a los oxígenos, en rojo, del extremo izquierdo se van a desprender. Ese movimiento de repulsión es lo que va a mover todos los procesos que necesitan energía en la célula.

Los tres fosfatos inorgánicos son moléculas cargadas negativamente, y están unos al lado de los otros. ¿Habéis intentado alguna vez unir dos imanes por polos semejantes? los imanes se repelen y hace falta mucha fuerza para juntarlos. Eso es lo que ocurre con los tres fosfatos inorgánicos. Están unidos covalentemente pero se repelen y cuando el enlace covalente se rompe el fosfato saliente sale repelido y ese movimiento de repulsión hace mover todas las máquinas enzimáticas de la célula.Una de las acepciones de la Real Academia de la Lengua Española sobre la palabra "parsimonia": Frugalidad y moderación en los gastos. Esta es una caracteristica de los seres vivos. Cuando algo funciona no se cambia. ¿Cómo se va a seleccionar mejoras en algo que ya es inmejorable? esto es lo que le ocurre a moléculas como el ATP. Su estructura es igual en cualquier organismo que miremos.

Ahora que sabemos que tanto el metabolismo anaerobio y el aerobio sirven para que la célula posea esta molécula energética, surge la siguentes dudas: ¿Por qué tenemos dos tipos de metabolismo? ¿Por qué si somos seres que respiramos oxígeno tenemos un metabolismo anaerobio que no utiliza oxígeno? Lo veremos en el siguiente capítulo

martes, 26 de abril de 2022

¿Qué fue de Excálibur? el perro sacrificado por sospecha de ébola

En 2014, el gobierno español repatrió a un misionero que había contraído el ébola en África. Se entiende la acción como un gesto humanitario. El problema es que supuso traer a un paciente 0 al país, trayendo consigo a un virus altamente contagioso cuando no tenían infraestructuras para tratarlo. Se produjo un circo mediático protestando sobre la improvisación del gobierno. Una enfermera se contagió de ébola y afortunadamente lograron salvarle la vida. No así al perro de la enfermera, Excalibur, que fue sacrificado en prevención. La enfermera pidió una indemnización. En 2022 ya tenemos resolución judicial.

Excalibur, el perro de la sanitaria Teresa Romero, sacrificado sin pruebas científicas de manera preventiva.

Condenada la sanitaria del ébola a 2.100 euros por denunciar el sacrificio de su perro. Titular excesivo: Más que condenada, tiene que pagar las costas de una denuncia que puso ella reclamando 150000 euros por daños morales.


¿Qué significó la pandemia para usted?

En 2003, en los seminarios del Departamento de Patogénesis Microbiana de la Universidad de Míchigan, en donde era investigador postdoctoral, los grupos de investigación que desarrollaban modelos matemáticos auguraban una próxima pandemia sobre el año 2015. Al final, la pandemia fue detectada en 2019, de ahí el nombre Covid-19. Esos mismos grupos, por 2003-2006, auguraban una pandemia posterior mucho más agresiva, que no tendría un origen natural, como la del Covid-19, sino un origen militar, probablemente producto de un ataque terrorista. Estamos esperando por esa nueva pandemia. La pandemia significó darme cuenta de qué significa el hecho de que las predicciones se pueden cumplir. Significó conocer qué significa una letalidad, la del SARS-CoV-2, de 0.5-1% cuando mi suegro, José Alberto Ramírez, falleció de Covid-19 en Caracas. ¡Qué vacío se sintió con su pérdida!.
Durante la pandemia y el confinamiento, ahorré tiempo. Lo aproveché para escribir y reflexionar sobre mi madre, fallecida en 2016, sobre mis hijos y lo que supone el alejamiento, la pérdida. ¡Qué fructífero fue reflexionar sobre lo que realmente es importante! sobre la cantidad de ruido que tenemos en nuestras vidas que no nos deja percibir lo que amamos. Entre 2021 y 2022 publicamos 5 artículos sobre esta pandemia. Esta pandemia no se ha acabado. Vendrán otras. Debemos reflexionar, prepararnos para minimizar en lo posible el daño y el sufrimiento, ahora que sabemos que las predicciones se pueden cumplir.

Bibliografía generada:

Biomarkers of severe COVID-19 pneumonia on admission using data-mining powered by common laboratory blood tests-datasets. Pulgar-Sánchez M, Chamorro K, Fors M, Mora FX, Ramírez H, Fernandez-Moreira E, Ballaz SJ. Comput Biol Med. 2021 Sep;136:104738. doi: 10.1016/j.compbiomed.2021.104738. Epub 2021 Aug 8.

Common laboratory tests as indicators of COVID-19 severity on admission at high altitude: a single-center retrospective study in Quito (ECUADOR). Ballaz SJ, Pulgar-Sánchez M, Chamorro K, Fernández-Moreira E, Ramírez H, Mora FX, Fors M. Clin Chem Lab Med. 2021 Mar 5;59(8):e326-e329. doi: 10.1515/cclm-2021-0156. Print 2021 Jul 27.

A Cross-Sectional Study to Assess Knowledge of COVID-19 among Undergraduate Students in North-Central Ecuador. Ortega-Paredes D, Larrea-Álvarez CM, Jijón SI, Loaiza K, Šefcová MA, Molina-Cuasapaz G, Barba P, Vinueza-Burgos C, Fernandez-Moreira E, Ramírez H, Larrea-Álvarez M.
Int J Environ Res Public Health. 2021 Aug 18;18(16):8706. doi: 10.3390/ijerph18168706.

An On-Line Cross-Sectional Questionnaire to Assess Knowledge of COVID-19 Pandemic among Citizens Tested for the SARS-CoV-2 Virus in Quito and Ibarra, Ecuador. Ortega-Paredes D, Zurita J, Zurita C, Leoro-Garzón P, Leoro-Monroy G, Larrea-Álvarez CM, Loaiza K, Fernandez-Moreira E, Molina-Cuasapaz G, Larrea-Álvarez M. Int J Environ Res Public Health. 2021 Feb 10;18(4):1691. doi: 10.3390/ijerph18041691.

Sex-Dependent Performance of the Neutrophil-to-Lymphocyte, Monocyte-to-Lymphocyte, Platelet-to-Lymphocyte and Mean Platelet Volume-to-Platelet Ratios in Discriminating COVID-19 Severity.
Fors M, Ballaz S, Ramírez H, Mora FX, Pulgar-Sánchez M, Chamorro K, Fernández-Moreira E.
Front Cardiovasc Med. 2022 Apr 8;9:822556. doi: 10.3389/fcvm.2022.822556. eCollection 2022.

jueves, 21 de abril de 2022

Cáncer de próstata y bacterias

 El estudio del microbioma de más de 600 pacientes con y sin cáncer de próstata agresivo reveló 4 nuevas bacterias presentes en los pacientes con cáncer de próstata agresivo y ausente en los pacientes sanos. Se identificaron  cuatro nuevas bacterias: Porphyromonas sp. nov., Varibaculum sp. nov., Peptoniphilus sp. nov. y Fenollaria sp.

Se nombró a la Porphyromonas como Porphyromonas bobii, y a la nueva especie de Varibaculum  Varibaculum prostatecancerukia,


Para saber más: 
 
Microbiomes of Urine and the Prostate Are Linked to Human Prostate Cancer Risk Groups. Rachel Hurst, R. et al. (2022) DOI:https://doi.org/10.1016/j.euo.2022.03.006

jueves, 14 de abril de 2022

Ya no eres tu, ahora eres yo

Dedicada a mi hija Flavia que me recomendó el video

Las tres relaciones básicas entre tú y los demás se pueden resumir en este gráfico:

Fig. 1. El territorio representado por el círculo puede ser equivalente a una célula o un individuo. En el primer caso, competición, si tu territorio está ocupado por él entonces es que te han comido o te han eliminado de tu territorio. En la simbiosis, ambos prevalecen en el mismo territorio. En el caso del parasitismo, el parásito es aquel que ocupa parte de tu territorio. 

Respecto al parasitismo, la frase que mejor ilustra la relación entre el yo y el parásito es la canción de Héctor Lavoe "¡Quítate tu pa´ ponerme yo!". Cymothoa exigua es un crustáceo que devora la lengua de los peces para vivir en ese espacio. Como el pez tiene que tragar y necesita la lengua, C. exigua hace las funciones de la lengua empujando el bolo alimenticio garganta abajo. 

Elysia marginata pierde la cabeza para desembarazarse de parásitos, como se puede ver en el video 1. Este comportamiento interesante. De alguna manera, la cabeza prevalece sobre el cuerpo que está infestado de parásitos. Lo que hace Elysia marginata es autotomizarse, es decir, separar la cabeza del cuerpo, para liberar a la cabeza del cuerpo parasitado. Elysia marginata, como otras especies de Elysias puede vivir sin sistema digestivo por que es capaz de robar los cloroplastos de las algas de las que se alimenta y exponerlas bajo su piel. Un robo de cloroplastos que se llama cleptoplastia, una especie de endosimbiosis.

Video 1. Esto Es Lo Que Todas Las Mantis Temen. Min. 4:40 Elysia marginata. Fuente WATOP

Lo que ocurre con la autotomización del cuerpo de Elysia marginata se podría representar de la siguiente manera: 

En el video se ve que realmente la autotomización elimina el 80% del cuerpo de E. marginata. Debe de compensarle cuando lo hace. A esta especie la simbiosis le parece bien, la competición también. Lo que no le gusta es el parasitismo. Este gesto indica, de alguna manera, una autopercepción de E. marginata. En 2018 hice una entrada sobre este tema: ¡Qué bien se vive sin parásitos!

En el video también se ve como muchos parásitos, como por ejemplo, los nematomorfos, o  Toxoplasma gondii, controlan la mente de los parasitados. Es fácil, al fin y al cabo no hay más que controlar principios básicos, a nivel neuronal, y esto hace del parasitado un zombie que trabaja para el parásito. Un poco lo que hacen los líderes de las sectas destructivas. Hay un conflicto entre yo y el. ¿Cómo me protejo de él? desarrollando sistemas inmunes. ¿Cómo él se protege de mi? pues manipulándome, haciéndome creer que yo soy él, que lo que me interesa es lo que él me propone. 

Thomas Hobbes, el pensador inglés del S XVII que fundó la filosofía política moderna, estableció que por interés propio las personas realizaban pactos con otras personas. Obviamente, estos pactos crean obligaciones que tenemos que cumplir. No vale el excusarnos en el interés propio cuando hemos firmado un pacto, o un juez ha establecido un pacto entre dos partes en litigio. Ser parte de una comunidad y aceptar sus beneficios implica la aceptación de la norma. Pero... hay individuos que por interés propio intentan no responsabilizarse de los pactos. Greg Velicer (Velicer et al, 2000) postuló que en una población homogénea de la bacteria social Myxococcus xanthus existen dos clases de individuos: los altruístas y los engañadores. Los que engañan suelen tener más fácil vivir a expensas de los otros.

Los psicópatas, perversos narcisistas y manipuladores también llevan una vida parasitaria. Viven de los recursos de los demás. Es habitual que en poco tiempo de conocerte se instalen en tu casa y pretendan no participar a medias en los gastos. La responsabilidad de cuidar a otras les queda grande. La irresponsabilidad es la que hace obligatoria la vida parasitaria: buscar a alguien que le aporte lo que ellos no pueden conseguir o simplemente no quieren hacerlo. Si tenemos cabeza, como Elysia marginata, debemos desprendernos de los parásitos para volver a ser nosotros mismos.

Bibliografía:

Velicer, G., Kroos, L. & Lenski, R. Developmental cheating in the social bacterium Myxococcus xanthus . Nature 404, 598–601 (2000). https://doi.org/10.1038/35007066

Para saber más:

Cymothoa exigua: quítate tu pa ponerme yo

Los cloroplastos y Elysia chlorotica

Elysia viridis o la importancia de ser simbiótica

miércoles, 13 de abril de 2022

La membrana es el saco de la avaricia

En el capítulo 2 hemos visto como, cuando apareció la primera célula, una arqueobacteria, uno de los primeros efectos que se observaron en el planeta fue la desaparición de la sopa biológica libre. Ahora, todos esos nutrientes, ricos en energía, iban a estar en el interior de membranas celulares, que no son otra cosa que un saco de avaricia. En ese momento, imaginemos como los mares, lagos y ríos del planeta iban poco a poco volviéndose más claros y transparentes. Muchas de esas arqueobacterias vivían en biopelículas. Había tantas que se producían acúmulos de ellas. Son lo que llamamos hoy en día estromatolitos. En la actualidad se los encuentra en ambientes extremos, como en Shark Bay en Australia, en el parque Yellowstone de Estados Unidos, o en la Puna Argentina.

Esto creó un conflicto entre los protovirus y las nuevas células arqueobacterianas. Como hemos visto en el capítulo 2, los protovirus perdieron por mutación los genes que codificaban para su propio ribosoma y ello no tuvo ningún impacto en sus vidas. Al replicarse esos protovirus, que habían perdido la capacidad de sintetizar su propio ribosoma, en el interior de las arqueobacterias podían utilizar el ribosoma de las arqueobacterias. Este ribosoma funcionaba igual que el de los protovirus, al fin y al cabo, el código genético es igual para todos los organismos porque todos procedemos de un único ancestro, el ribozima primordial, al que llamamos LUCA. Ahora, sin ribosoma, los protovirus se llaman virus y siguen entre nosotros. 

La avaricia, el afán de acaparar y la preocupación por que no te arrebaten lo que has acumulado surge en las arqueobacterias cuando desarrollan sus membranas.  Cuando hay avaricia, hay acumulación, hay ganadores y perdedores... hay drama. Y donde hay drama hay entretenimiento. De todo este drama surge el individuo, el protagonista de la historia. Aquel que tiene que luchar contra todo y todos para  prevalecer... ¿Lo que nos ocurre a nosotros verdad? por eso nos identificamos con los protagonistas de las historias. ¡Vamos allá!

Membrana celular: ¡Dónde hay una frontera hay un territorio!

Los protovirus entraron en las arqueobacterias que previamente les habían arrebatado los nutrientes que se encontraban libres en la sopa biológica. Las arqueobacterias, de repente, se las tuvieron que ver con unos agentes que entraban en su interior, se replicaban a sus expensas, o incluso acababan con ellas. Si, cuando las arqueobacterias desarrollan la membrana celular, éstas ganaron muchísimo espacio extra, precisamente ese espacio había que defenderlo de agentes biológicos extraños. Una membrana celular es un territorio. Como territorio hay que defenderlo, poner barreras... También implica una relación entre nosotros y ellos. Veamos: 
Fig. 1.  El territorio representado por el círculo es el equivalente al interior que define la membrana celular. En el primer caso, competición, se supone que tu territorio debería ser azul, es decir, tu territorio. Si tu territorio está ocupado por él entonces es que te han comido o te han eliminado de tu territorio. En la simbiosis, ambos prevalecen en el mismo territorio. En el caso del parasitismo, el parásito es aquel que ocupa parte de tu territorio.

Hay un conflicto entre el yo y el él. ¿Cómo me protejo de él? desarrollando sistemas inmunes. ¿Cómo él se protege de mi? pues manipulándome, haciéndome creer que yo soy él, que lo que me interesa es lo que él me propone. Es algo a lo que volveremos más adelante. 

El desarrollo de sistemas inmunes en bacterias: enzimas de restricción y sistemas CRISPR-Cas sirven para eliminar a los virus, parásitos o depredadores. Es una consecuencia de tener un territorio, el tener que protegerlo de agentes externos. Cuando estos sistemas funcionan podemos deshacernos de los depredadores y parásitos. De esa manera, conquistamos con el color azul que nos identifica. Nuestro territorio nos pertenece.
Fig. 2. Para reconquistar su territorio celular, las arqueobacterias desarrollaron dos sistemas inmunes, uno innato como son los sistemas de enzimas de restricción y otro adaptativo como el sistema CRISPR-Cas.

Cuando el parásito es capaz de sortear a nuestros sistemas inmunes no nos queda más remedio que pactar y llegar a una simbiosis. Se ha propuesto que las mitocondrias fueron parásitos energéticos antes de convertirse en orgánulos de la célula eucariota (Wang & Wu, 2014). 

La membrana permitió tener espacio extra

Las células están separadas del medio que las rodea por una delgada lámina denominada membrana plasmática, que define los límites de las mismas. Sin esta barrera protectora, las células estarían expuestas a los rigores del mundo externo, no podrían regular su medio interno y, en consecuencia, no serían viables. La membrana plasmática no aísla a la célula completamente sino que constituye una barrera altamente selectiva, que tiene la propiedad de regular el intercambio de materiales entre la célula y el medio que la rodea.

La membrana es una estructura muy delgada: sólo tiene un espesor de 5 a 10 nm (1nm=10-9m). Por lo tanto, se necesitarían mil membranas plasmáticas apiladas, una sobre otra, para igualar el espesor de esta hoja de papel. Precisamente debido a su delgadez, cuando se examina una célula al microscopio óptico convencional, puede observarse sin dificultad el interior de la misma; en el mejor de los casos podrá apreciarse el contorno de la membrana, pero nunca podrá distinguirse su ultraestructura. Con el al microscopio electrónico se puede ver la ultraestructura de las membranas celulares y ¿Adivina qué? es para todos los seres vivos la misma estructura. Esta estructura se denominó unidad de membrana y la misma no sólo es válida para la membrana plasmática, sino para casi todas las membranas celulares, desde una bacteria, a una planta, un humano o una ballena. Todos tenemos membranas celulares similares.

La membrana permitió el desarrollo del dogma de la biología molecular

El aumento de espacio que generó la membrana celular permitió la expansión del discurso genético. Me explico, tener organismos que guardan toda su información exclusivamente en cadenas de ARN es complicado. La razón, es que la ARN polimerasa, la enzima que polimeriza el ARN es poco eficiente a la hora de copiar con exactitud la información. El ADN presenta una serie de ventajas como soporte de información. Vamos a ver: el ADN es una molécula menos oxigenada que el ARN porque su azúcar es la desoxiribosa (desoxi- sin un oxígeno). Por lo tanto, el tener menos oxígeno hace a la desoxiribosa del ADN ser más estable químicamente. El ADN tiene más rigidez que el ARN porque la timina, la base nitrogenada equivalente al uracilo del ARN es más voluminosa al tener un metilo más en su estructura a comparación del uracilo, que es exactamente igual pero sin este grupo funcional. Esto favorece que el ADN forme doble cadenas. Además, tener la información en un formato en doble cadena permite detectar las mutaciones de manera eficiente, lo cual es un ventaja cuando la información que vas acumulando es valiosa. Al tener la información en un soporte de doble cadena, si aparece un cambio, una mutación, siempre tienes la otra cadena como molde para poder corregirlo. Es un mecanismo que permite conservar la integridad del mensaje que quieres pasar a la siguiente generación.



Fig. 3. Los seres vivos seguimos lo que se ha venido a llamar el dogma de la biología molecular, esto es, que la información genética está en el ADN se pasa a ARN mediante la ARN polimerasa (5) y de ahí a proteínas por el ribosoma (2). El ADN sería el disco duro y se autorreplicaría por la ADN polimerasa (4). La información que se guarda ahí es permanente. Según se necesite, esa información se lee a ARN y este ARN es temporal y de ahí se traduce a proteínas. En el dogma genético actualizado sabemos que hay organismos que solo tienen ARN como material genético (los virus ARN) y para autorreplicarse utilizan la ARN replicasa (1). Hay virus que son capaces de pasar su información en ARN a ADN, como los retrovirus, a esa enzima se le llama retrotranscriptasa (3).

En 1957, Crick, el codescubridor de la estructura del ADN expuso el "dogma central de la biología molecular", que explicaba que el flujo de información iba del ADN al ARN y finalmente a las proteínas (Fig. 3). Tal y como fue enunciado consideraba que la información genética codificada en el ADN se copia mediante la transcripción y pasa al ARN mediante la ARN polimerasa (5), sirviendo posteriormente para sintetizar un polipéptido, proceso denominado traducción mediante el ribosoma (2). Se creía que la única biomolécula capaz de replicarse era el ADN (4). Este dogma fue modificado en 1970 por Howard Tenin y David Baltimore con el descubrimiento de la enzima retrotranscriptasa.

Una excepción al dogma la constituyen los retrovirus, que contienen ARN y una enzima especial, llamada transcriptasa inversa o retrotranscriptasa, capaz de sintetizar una cadena de ADN complementaria del ARN vírico, proceso denominado transcripción inversa o retrotranscripción (3). Esta retrotranscriptasa apareció cuando los organismos ARN empezaron a utilizar el ADN como un soporte seguro para su información, mucho más protegido de las mutaciones. Lo que es valioso hay que conservarlo bien, y la información que la evolución y el tiempo van modelando es necesario que no se malogre con mutaciones al azar que corrompan su significado. Otra excepción se debe a la replicación del ARN (5), proceso antidogmático que se descubrió al observar que algunos virus eran capaces de replicar su genoma de ARN, proceso que cataliza la enzima ARN replicasa. Esta replicasa era la única molécula autorreplicativa cuando no existía el ADN, es, a diferencia de la ARN polimerasa, una ARN polimerasa dependiente de ARN.

Video 2: ¿Código genético basado en ADN?. Fuente: Actuaciencia

El organismo que desarrolló la primera membrana plasmática fue un organismo con ADN como material de soporte de información hereditaria. Un organismo que, como los computadores, tiene un disco duro, el ADN, esta información se pasa a la memoria RAM, que es una memoria temporal, lo que vendría a ser el ARN y de ahí se traduciría en los ribosomas a proteínas.  En las computadoras el disco duro almacena permanentemente. Cuando se necesita trabajar con esa información, se pasa a una memoria temporal que es la memoria RAM. 

Las membranas, a diferencia de las cápsides proteicas de los virus que tienen que desarmarse para que el material genético se replique, mantienen al material genético dentro de sus límites. De esa manera evitan el problema que tienen los virus cuando están en presencia de otros virus: que aparezcan recombinaciones no deseadas. Esto es lo que ha ocurrido con el SARS-CoV-2, que un coronavirus humano se replicaba en una célula en donde por casualidad había entrado un coronavirus de murciélago y ambos ARN se mezclaron, resultado un nuevo virus que originó una pandemia. Por tanto, para un organismo, tener a su material genético confinado detrás de una membrana es una garantía de que no va a haber recombinaciones con ADN de otros organismos... al menos en teoría, como veremos más adelante.

Definen la extensión de la célula y establecen sus límites

Las membranas celulares constituyen barreras selectivamente permeables, dado que impiden el intercambio indiscriminado de sustancias entre el citoplasma y el medio extracelular. La membrana celular, gracias a sus propiedades fisicoquímicas, está capacitada para transportar de un lado a otro de la misma determinados solutos, macromoléculas y complejos macromoleculares. Estas propiedades le permiten a la célula interaccionar con el medio extracelular (tanto con la matriz extracelular como con otras células vecinas). Permite a las células reconocerse, adherirse entre sí cuando sea necesario e intercambiar materiales e información.

La membrana posee receptores, que son moléculas o conjuntos de moléculas, capaces de reconocer y responder a señales provenientes del medio extracelular portando información específica. Cuando dichas señales llegan hasta la membrana plasmática, se desencadenan señales internas en la célula, tanto activadoras como inhibitorias de distintos procesos celulares. 

Singer y Nicholson propusieron en 1972 un modelo estructural para las membranas al cual denominaron modelo del mosaico fluido. De acuerdo al mismo las membranas son “disoluciones bidimensionales de lípidos y proteínas”. Según este modelo, la estructura de la membrana sería una delgada lámina formada por dos capas superpuestas de lípidos (también llamadas hemimembranas), con la fluidez propia de los aceites, en la cual se encuentran insertadas proteínas. Esto le confiere el aspecto de un “mosaico”.

Las membranas no son estructuras estáticas ni rígidas. Están formadas por un conjunto de moléculas hidrofóbicas e hidrofílicas que se mantienen unidas por enlaces, en general, no covalentes. Una de las principales características de las membranas biológicas es su alto grado de fluidez. Esto implica que sus lípidos y proteínas pueden desplazarse libremente en todas las direcciones, pero siempre sobre el plano de la membrana. De allí entonces la denominación de “mosaico fluido”; a esta propiedad también se la conoce como difusión lateral.

Se generan diferencias químicas cuando hay una frontera

Como ya se ha mencionado la membrana plasmática es una barrera con permeabilidad selectiva que regula el intercambio de sustancias entre el citoplasma y el medio extracelular. Sus propiedades aseguran que las sustancias esenciales, como la glucosa, los aminoácidos y los lípidos entren a la célula fácilmente, que los intermediarios metabólicos permanezcan en la célula y que los productos de desecho, como la urea, abandonen la misma. 

Todo esto permite a la célula mantener el medio interno relativamente constante. La membrana, debido a sus características hidrofóbicas, es impermeable a la mayor parte de las moléculas hidrosolubles, como la glucosa, los aminoácidos y los iones en general, de esa manera, a pesar de ser una estructura muy fina es altamente eficiente a la hora de guardar moléculas orgánicas. 

La membrana celular puede ser atravesada fácilmente por las moléculas no polares y pequeñas como el O2, CO2, N2 e incluso el CO (tóxico), compuestos liposolubles como los ácidos grasos y esteroides y, además, a pesar de ser moléculas polares, el glicerol, la urea y el agua. El resto de las moléculas se transfiere de un lado a otro de la membrana gracias a proteínas integrales que actúan como transportadores; sin estos transportadores dichas moléculas no pueden difundir a través de las membranas. Estos transportadores se van a abrir o a cerrar de una manera regulada que favorezca a la célula. De esa manera, la célula puede conquistar nuevos ambientes, nuevos territorios.

El interior de la célula tiene memoria

Como se puede observar en la figura 4, las bacterias son capaces de heredar a sus hijas el nivel de activación o de inactivación de genes. Esto no quiere decir que las bacterias hijas heredan genes distintos a sus progenitores. Heredan exactamente el mismo cromosoma que tienen sus progenitores, lo único distinto es que pueden encender o apagar genes distintos, según los estímulos recibidos y hacer que su descendencia herede el patrón de apagado o encendido.

Fig. 4. El citoplasma bacteriano tiene la capacidad de modificar el ADN de la bacteria, y las bacterias hijas heredarán lo que se haya modificado en la generación anterior. Esta propiedad se llama epigenética. Una célula A se divide y da lugar a dos células hijas iguales: B y C. B y C reciben estímulos externos distintos, en la imagen representados por las flechas amarilla y azul. Esto hace que expresen factores de transcripción adecuados a las nuevas condiciones externas. Estos factores de transcripción van a modificar los genes de las bacterias B y C. Los genes modificados van a quedar activos, representados por la carita feliz o inactivos, representados por la señal de prohibición. Las células hijas de B y C, a pesar de que no han tenido los estímulos externos de sus progenitoras, conservan el patrón de encendido y apagado de la generación anterior. Fuente: Actuaciencia

Vamos a ver un ejemplo: el sistema MDR (por sus siglas en inglés "Multidrug Resistance System"). Si exponemos bacterias a concentraciones subinhibitorias, es decir, que no las matan, de antibióticos, las bacterias encenderán los genes que van a generar bombas de eflujo que les ayuden a bombear fuera de la célula al antibiótico. Una manera de preservar la identidad física de lo que está en el interior de su membrana. ¿Cómo se encienden o apagan genes? mediante la metilación del ADN, las modificaciones de proteínas que sirven para empaquetar el ADN y los ARN no codificantes. Mediante estas tres estrategias las bacterias pueden hacer que su ADN produzca lo que necesita para protegerlas bajo las nuevas condiciones ambientales. De este modo, aunque existan cantidades elevadas de antibióticos, las bacterias pueden resistir ese veneno. Es importante mencionar que este mecanismo dura unas cuantas generaciones incluso en ausencia de antibiótico. Al paso del tiempo, si no hay antibiótico en el medio, las bacterias destruyen sus bombas de eflujo volviendo a su estado original en la que no están especialmente preparadas para resistir al antibiótico. 

Esta capacidad que tiene el citoplasma de modificar el ADN de la bacteria ha sido utilizado por bacterias que viven en el interior de células eucariotas, como por ejemplo las famosas: Mycobacterium tuberculosis, causante de la tuberculosis, Helicobacter pylori, causante de la úlcera de estómago, Escherichia coli, causante de cistitis, Listeria monocytogenes, Pseudomonas aeruginosa, y Legionella pneumophila... Pero ya hablaremos más adelante de todo esto.

Acumular material de reserva: crecimiento exponencial versus postexponencial

La membrana permitió acumular material de reserva. El hecho de que esas arqueobacterias acaparasen todas las moléculas orgánicas que flotaban libres en la sopa biológica primordial ya indicaba que la membrana es un saco para la avaricia. Esto ha hecho que las arqueobacterias iniciales empezasen a almacenar las moléculas sobrantes en polímeros como polisacáridos, lípidos, polifosfatos o  azufre líquido en forma de esferas que se observan como puntos refringentes de luz al microscopio. ¿Por qué las guardan como polímeros? porque si guardan esas moléculas como monómeros aumentaría la presión osmótica en el interior de la célula. Las moléculas individuales atrapan más agua que si están empaquetadas en moléculas más grandes. Pequeños trucos bioquímicos de una membrana que siempre tiene que estar en un ambiente húmedo. Cuando es necesario, vuelven a ser monómeros y sirven como fuente de carbono y energía, prolongando la vida bacteriana en ausencia de alimento.

Las hifas son un ensayo de pluricelularidad: el caso de Thiomargarita

La bacteria Thiomargarita magnifica, es una bacteria con una longitud celular promedio mayor a 9,000 µm, es decir, 9 mm. Una bacteria que es visible a simple vista. Ya no hablamos de microbios sino de macrobios. Esta bacteria posee una biología única como es tener una poliploidía sin precedentes de más de medio millón de copias de un genoma muy grande. Asimismo tienen un ciclo de vida dimórfico con segregación asimétrica de cromosomas en células hijas. Estas características, junto con la compartimentación del material genómico y la síntesis de proteínas en orgánulos unidos a la membrana, indican una ganancia de complejidad en el linaje Thiomargarita y desafían los conceptos tradicionales de las células bacterianas. Es muy interesante observar que todo su ADN se encuentra dentro de una bolsa membranosa, unida a la pared celular. Esto ayuda a que su núcleo se mantenga protegido de cualquier agente externo. Algo de lo que carecen sus parientes bacterias y arqueas, cuyo material genético flota libremente dentro de sus células. Además, también lleva una segunda bolsa llena de agua, que ocupa más del 70% del volumen total de su cuerpo según comentan los científicos. Esta bolsa llena de agua aplasta todo el contenido de la célula contra las paredes de la bacteria, lo que le ayuda a eliminar toxinas con facilidad.Esta nueva Thiomargarita desbanca a otra Thiomargarita, la Thiomargarita namibiensis, como la bacteria más grande descubierta por la ciencia. Si la longitud de Escherichia coli es de 3 um y T. magnifica tiene 9000 um, esto quiere decir que es 3000 veces más grande

Una ballena azul adulta pesa 150 toneladas, 150.000 kg. Si lo comparamos con un humano de 75 kg sería 2000 veces más pesada. Thiomargarita magnifica es 3000 veces más larga que E. coli.Los segmentos al final del filamento son células hijas en ciernes. Los cientos de miles de copias del genoma de estas células gigantes están contenidas en pequeñas estructuras unidas a la membrana a lo largo de toda la célula.

¿Cómo mantener el volumen? Tres tipos de membrana bacteriana

Una membrana define un volumen. Ese volumen va a estar expuesto a presiones externas que lo deformen. Un volumen, como estructura de tres dimensiones tiene que evitar ser aplastado. Las primeras bacterias en aparecer, las arqueobacterias, parece que han tenido que lidiar con este problema. Las arqueobacterias son difíciles de estudiar por que crecen en ambientes extremos en calor, presión, acidez... Por ejemplo, Pyrococcus furiosus, una arquea que solo crece a temperaturas mayores de 100ºC. En 2015 se descubrieron unas arqueobacterias que se han venido a llamar Lokibacterias en un sistema de ventilación hidrotermal está entre Groenlandia y Noruega a una profundidad de 2.352 metros. Estas bacterias se dividen cada 10 años. Poseen 5 genes distintos de una proteína similar a la actina, la proteína del citoesqueleto de las células eucariotas (Spang et al, 2015). Parece que usan un citoesqueleto igual que nuestras células. Esto entusiasmó a los biólogos por que serviría para sostener la hipótesis de que la membrana de nuestras células provendría de un antepasado común con estas Lokibacterias. 

Las membranas de las arqueobacterias son diversas, por ejemplo, hay bacterias dentro de este grupo que tienen membranas de una monocapa de bifitanilos, otros grupos de bacterias tienen membran bicapa de fitanilos. La mayoría parece que tienen además de la membrana una pared celular. Las Lokibacterias parece que tienen esqueleto. Una diversidad de membranas apabullante. Si no se sabe más es por la dificultad que tiene trabajar con estos microorganismos, además, no se conoce ninguna arqueobacteria que cause enfermedad en humanos. Por eso no hay dinero para estudiarlas: ¡No nos causan problemas!.

Las eubacterias como las Gram positivas y negativas tienen dos tipos de membranas muy características. Son bacterias que tienen una alta concentración de sales en su interior y por ese motivo tienen una elevada presión osmótica. Aproximadamente las Gram positivas tienen 25 atm de presión interna y las Gram negativas entre 1 y 5 atm. Para evitar que esta presión haga explotar su membrana plasmática, ésta está rodeada de una capa de peptidoglicano. Por tanto, las Gram positivas tienen así como 5 veces más peptidoglicano que las Gram negativas. La manera en la que mantienen su volumen sin deformar es a base de tener una gran presión interna contenida por esa malla externa de peptidoglicano.

Una interfaz dinámica para relacionarte con un mundo cambiante (Huella dactilar)

La membrana, además de ser un saco que le permite a la célula acaparar un espacio, también es su carta de presentación al mundo. La composición y los distintos elementos que la rodean le dan un aspecto que le permiten protegerse, atacar, pasar desapercibida, reconocer a sus amigas etc. Por ejemplo, Neisseria gonorrhoea, para sus fines delictivos en el organismo humano, varía su aspecto ente amenazante y de camuflaje, Streptococcus pneumoniae desarrolla una cápsula para protegerse, desarrolla esta cápsula cuando está asustada. E. coli tiene unos parches de lípidos misteriosos en su membrana... todavía no sabemos para que sirven.

Engolosinados con el ADN y las proteínas, los científicos hemos dejado a los azúcares de lado, debido a que los azúcares son la última frontera en biología. Lo que se conoce de azúcares está a años luz de lo que sabemos del ADN o de las proteínas. Es relativamente fácil trabajar con las proteínas o el ADN. Las técnicas están bien establecidas. Ayuda mucho el hecho que las proteínas son aminoácidos traducidos a partir de los tripletes de ADN. Así, si modificamos el ADN podemos producir cambios en las proteínas y eso nos ayuda a entender su función. No sucede lo mismo con los azúcares. Es difícil producir cambios en su estructura. En ciencia nos hemos limitado a inactivar las enzimas encargadas de que un azúcar se incorpore a una estructura mayor. Digamos que los biólogos moleculares han estado engolosinados trabajando con ADN y proteínas y han dejado los azúcares de lado.

Lo hermoso del glicocalix es que además de las funciones obvias de lubricación, de permitir un espacio para mantener la estructura de la célula o los órganos o para organizar el agua y los nutrientes es que se trata de un código de información ¿Alguien ha dicho código? Cuando hablamos de códigos atraemos a personas muy inteligentes a los que les gustan los retos. De repente lo aburrido se vuelve atractivo. Hoy en día, biólogos moleculares, de sistemas y computacionales están estudiando los códigos de azúcares, lo que se ha venido llamando el glucidoma, para comprender un nuevo lenguaje.

Y como siempre, el origen está en la membrana de las bacterias. En las bacterias más primitivas, las arqueobacterias, además de la membrana plasmática, en el exterior tienen una pared celular constituídas de capas S de glucoproteínas, pseudopeptidoglicano o polisacáridos. En las eubacterias, la pared celular se compone de peptidoglicano que actúa como una malla que evita que la presión osmótica interna de la bacteria descomponga la membrana plasmática. Estas paredes celulares son estructuras organizadas, con límites definidos. Además, pueden tener un glicocalix que no tiene límites definidos y se deforma con facilidad. Además, pueden exudar materiales poliméricos para crear biopelículas.

Fig. 5. Material exudado polimérico extracelular compuesto por proteínas y carbohidratos producidos por las bacterias en 1 la pared celular, 2  el glicocalix o 3 la biopelícula (biofilm) son un material exudado polimérico extracelular. Este material también está producido por células eucariotas las epiteliales de las superficies mucosas. Fuente

La primera vez que la humanidad se dio cuenta que nuestra herencia estaba escrita en el ADN fue en 1944, precisamente estudiando el glicocalix de Streptococcus pneumoniae. Recientemente, hemos descubierto el primer sistema de memoria colectiva estudiando las biopelículas de Pseudomonas aeruginosa. De esa manera, estamos descubriendo que ese glicocalix es algo más que una película mucosa de glucoproteínas.
 
Las propiedades del glicocalix, que se estudian en las células y tejidos humanos, se exhiben, por tanto, en bacterias y en comunidades de bacterias como las biopelículas. El glicocalix es ese espacio de glucoproteínas y glucolípidos que sirve para mantener hidratadas a las células, que canaliza los nutrientes, que sirve como una especie de columna vertebral mucosa para el soporte de las membranas, contribuye al reconocimiento, comunicación y adhesión entre células. Los distintos tipos de glicocalix sirven también para identificar a una comunidad de células y así diferenciar lo propio de lo ajeno.

Las bacterias surgen hace 4000 millones de años y los seres pluricelulares, como nosotros, aparecen hace solo 1000 millones de años. Las tres cuartas partes del tiempo de evolución del glicocalix se dio exclusivamente en bacterias protozoos. Ese mecanismo de adhesión y reconocimiento entre células, con todo lo que ello implica: memoria, comportamiento social, diferenciar lo propio de lo ajeno, estaba ya listo antes de la aparición de organismos pluricelulares. En este momento, el glicocalix sirvió para guiar el movimiento de las células que empezaban a dividirse en linajes para que se agrupasen en tejidos.

Hoy en día, la medicina está comprobando que incorporar al glicocalix en nuestro mapa conceptual del cuerpo humano es imprescindible para entender múltiples procesos: la inmunidad de la infección, como defendernos del cancer, las enfermedades cardiovasculares, la compatibilidad de los transplantes o los defectos en el desarrollo embrionario.

Guerras en el interior de la frontera

El interior de la membrana, en el espacio llamado citoplasma, se comienza a librar una batalla por el territorio. Virus queriendo replicarse en lo que era su antigua sopa biológica. La nueva entidad, la arqueobacteria, tratando de defenderse de los intrusos. Como en todo conflicto, surgen armas, defensas y estrategias de lucha.

El hecho de que los virus depredan o parasitan a la célula motivó una presión selectiva que hizo que las células desarrollasen sus sistemas de defensa. Las bacterias se defienden, básicamente, con dos sistemas inmunológicos, al igual que los humanos, un sistema inmunológico inespecífico, que comprende cápsulas mucosas, bombas de eflujo y las enzimas de restricción que destruyen el ADN de los virus que tratan de entrar en su interior y un sistema inmunológico adaptativo, esto es, que tiene memoria de infecciones pasadas. Se trata de los sistemas tipo CRISPR-Cas9 de los que hablaremos más adelante. 

Los virus básicamente hacen dos cosas: o entran en el interior y aprovechan para hacer copias de si mismos y escapar de esa célula agotada para infectar a otras células, o integran su ADN en el de la bacteria hospedadora. Para permanecer en el interior de ese espacio que no es suyo los virus desarrollaron el egoismo. El sistema en el que se basa su egoismo se le llama "Sistema toxina-antitoxina". 

O mía o de nadie: el egoísmo hecho sistema biológico

Los virus rechazados por los sistemas inmunes de las arqueobacterias desarrollaron estrategias para controlar a aquellas ingratas que nos se dejaban dominar. Hay sistemas sociales que tienen semejanzas con este tipo de sistemas toxina-antitoxina. Por ejemplo la pertenencia a: mafia, determinadas sectas, partidos de extrema derecha o extrema izquierda, grupos terroristas... Todos lo hemos visto en las películas: una vez que entras en la mafia no puedes salir, lo mismo con los grupos terroristas. Una vez estás dentro la única salida del grupo es la muerte. 

Los virus que se integraban en el genoma del virus o que permanecían en el interior de la célula como un minigenoma circular, los llamados plásmidos, tenían dos genes, uno al lado de otro. El primero codificaba para un veneno para la célula, el otro codificaba para una antitoxina. Esta antitoxina podía ser de dos tipos, o bien un ARN que impedía que el veneno se formase o bien podía codificar para otra proteína que al unirse al veneno lo inactivase. El truco reside en la vida media del veneno y de la antitoxina. El veneno, como molécula, tiene una vida larga. Se produce tarde bastante tiempo en degradarse. En cambio la antitoxina, como molécula, tiene una vida corta. Hay que estar produciendo nuevo antitoxina todo el tiempo. Pero para producirlo, la célula tiene que tener los dos genes del virus: el de la toxina (veneno) y el de la antitoxina. En en video 3 se observa el caso en el que una célula al dividirse una de las células hijas lleva el plásmido y la otra carece de él. Lo que ocurrirá es que la célula en la que no va el plásmido acabará muriendo al no tener gen que produzca la antitoxina, cuando esta se acabe, no habrá molécula capaz de inactivar al veneno que ahora matará a la célula libre del virus parásito.

Este sistema toxina-antitoxina no solo es un mecanismo de egoismo muy elegante, sino que además, ese sistema permite el siguiente paso de la evolución: el de la multicelularidad, en donde unas células se aprovechan de las otras. No me canso de recordar, los humanos no somos más que protozoos que se aprovechan de un cuerpo multicelular... nosotros, nuestro cuerpo es un cadaver, la única parte viva de nosotros son aquellos protozoos unicelulares que llamamos espermatozoides u óvulos que encuentran a su complementario para formar el nuevo individuo. Me explico, yo, como individuo cuando tenga alrededor de 90 años me estaré muriendo si no me he muerto antes. Las únicas células mías que pervivirán en el tiempo han sido dos de mis espermatozoides que encontraron un óvulo y a partir de ahí ese nueva célula con dotación cromosómica 50% proveniente de mi espermatozoide y 50% proveniente de ese óvulo seguirán con vida hasta que su célula sexual pueda encontrar otra célula sexual y generar la tercera generación, lo que llamamos niet@. 

El sistema toxina-antitoxina MazEF, por ejemplo, se encuentra en E. coli y otras bacterias (Mochizuki et al. 2006). Cuando en el medio hay escasez de alimento, en concreto escasez de aminoácidos, este sistema conduce a la bacteria a la muerte. En una población de bacterias E. coli habrá un número de ellas que se suiciden y liberen al medio los contenidos del interior de esa membrana que los acaparaba, para ser absorbidos por células de E. coli vecinas. Este es un mecanismo de altruismo en el que la muerte de algunas evita la muerte de todas. En el fondo, es lo que resume la vida de los humanos. Desde un punto de vista exclusivamente biológico vivimos exclusivamente para dejar a esos dos protozoos que nos van a sobrevivir en condiciones de tener éxito en la vida.​

BIBLIOGRAFÍA
Wang Z, Wu M (2014) Phylogenomic Reconstruction Indicates Mitochondrial Ancestor Was an Energy Parasite. PLoS ONE 9(10): e110685. https://doi.org/10.1371/journal.pone.0110685

Crimi, E., Benincasa, G., Cirri, S., Mutesi, R., Faenza, M., & Napoli, C. (2020). Clinical epigenetics and multidrug-resistant bacterial infections: host remodelling in critical illness. Epigenetics, 15(10), 1021–1034. https://doi.org/10.1080/15592294.2020.1748918

A centimeter-long bacterium with DNA compartmentalized in membrane-bound organelles.
Volland et al. bioRxiv 2022.02.16.480423; doi: https://doi.org/10.1101/2022.02.16.480423

Spang, A., Saw, J., Jørgensen, S. et al. Complex archaea that bridge the gap between prokaryotes and eukaryotes. Nature 521, 173–179 (2015). https://doi.org/10.1038/nature14447

Mruk I, Kobayashi I. To be or not to be: Regulation of restriction-modification systems and other toxin-antitoxin systems. Nucleic Acids Res. 2014;42(1):70-86.

Wen Y, Behiels E, Devreese B. Toxin-Antitoxin systems: Their role in persistence, biofilm formation, and pathogenicity. Pathog Dis. 2014;70(3):240-9.

¿Un sistema morse fúngico?

Picos eléctricos agrupados en hongos 

El Dr Adamatzky insertó microlectrodos en las hifas de cuatro especies de hongos y analizó los patrones de picos eléctricos que se producían cuando el hongo se encontraba con una fuente de alimento.

Los hongos con sus electrodos. ¿Un poco gordos estos electrodos? perdón por mi desconfianza de cuñado

Las hifas, que son cadenas de células en forma de tubo, funcionarían de esa manera como una neurona transmitiendo electricidad de un extremo al otro. Observó que estos picos eléctricos a menudo se agrupaban en secuencias que se asemejaban a vocabularios de hasta 50 palabras. De hecho, descubrió que la distribución de estas "longitudes de palabras fúngicas" coincidía estrechamente con la de los idiomas humanos. 

Los picos eléctricos después de 5 días de registro son similares a un código de barras (a) C. milataris, (b) F. velutipes

El código Morse se basa en que la longitud y tiempo entre los puntos y rayas se controlan cuando se presiona una tecla, entonces la señal está "on" (encendida) y "off" (apagada) cuando se suelta. Si la longitud de on tiene dos tiempos:  corta para representar un punto y larga para representar una raya, entonces podemos crear un alfabeto de la siguiente manera: 

Baja modesto que sube Adamatzky

De ahí a decir, como propone en su artículo, que ha descubierto un lenguaje fúngico media un grandísimo trecho. Otro tipo de científico sería mucho más cauto y se ceñiría exclusivamente a lo que ha descubierto: que existe una comunicación con picos eléctricos y que presentan una estructura modular. De ahí a decir que ha descubierto un lenguaje solo se explica desde el deseo que tienen las personas de ciertos grupos culturales, étnicos o religiosos de ¡Querer a toda costa iluminar a los gentiles!. En el fondo, es un mecanismo muy curioso que merece la pena que sea investigado: hablar yo para que no hables tu. Este aforismo sigue también una estructura darwiniana: si me reproduzco permanezco y aumento mi frecuencia en la población de discursos. No solamente estaríamos impelidos por nuestra biología a dejar el máximo de descendencia sino que a nivel cultural también, nuestra propia cultura, trataría de imponerse a la de los demás. 

Ahora bien, aunque las "conclusiones" son precipitadas y ambiciosas hay que reconocer que es una idea muy interesante y osada. El lenguaje sirve para optimizar los recursos y si comunicarnos sirve para dejar más descendencia ese "descubrimiento" va a seguir evolucionando. Tiene lógica evolutiva. De igual manera, hay personas que hablan por que tienen algo que decir, y los demás lo que mejor que podemos hacer es quedarnos callados, especialmente porque si adoptamos una estrategia para defendernos de ese discurso que es mejor que nosotros, esa estrategia siempre será vil y despreciable.

martes, 12 de abril de 2022

Y el verbo se hizo carne

 Y el verbo se hizo carne (y se traduce a proteínas)

Ya tenemos un texto escrito en ARN. Un texto de cuatro letras constituidas por los cuatro nucleótidos adenina, citosina, guanina y uracilo. Ya hemos visto, que incluso en un texto lineal como lo es una molécula de ARN puede existir dopplergangers: secuencias invertidas, especulares, complementarias... La unidimensionalidad esconde estructuras de dos dimensiones... esas estructuras van a dar una molécula tridimensional, y esa molécula, por medio de la selección natural irá cambiando en el tiempo, es decir, va a reflejar la cuarta dimensión en su composición. 

El estudio de significados ocultos en los textos del Pentateuco, que en la tradición hebrea forman la Torá, núcleo de la religión judía (Génesis, Éxodo, Levítico, Números y Deuteronomio, tuvo su origen en la España de los siglos XII y XIII, especialmente en las juderías de Guadalajara y Zaragoza. La lectura cabalística artificial utiliza tres mecanismos analíticos básicos: Gematría, Notaricón, Temurá. Cada letra del alfabeto hebreo, como elemento creador tiene asignado un número, lo que confiere significados crípticos a la Torá. 

Si un texto alfabético admite ese grado de complejidad, pensemos en ese mundo de ribozimas replicándose en el barro, evolucionando... alcanzando niveles altísimos de sofisticación. De repente, esa información escrita en cuatro letras da un salto cuando una máquina, el ribosoma, del que hablaré más adelante, les permite traducir la información del ARN a un código químicamente más versátil: las proteínas basadas en cadenas de aminoácidos. De repente, el verbo, las ribozimas, se hacen carne. 

Fig. 1. La creación de Adán por Miguel ángel. El verbo se hizo carne. 

Para convertir, traducir, toda la información que acumula el ARN necesitamos un código para traducir esa información a un nuevo código. Por ese motivo, vamos a ver

¿Qué es el código genético?

Para explicar el código genético voy a utilizar otro código muy utilizado como analogía: el código máquina de nuestros computadores. La información digital se guarda en ceros y unos, los famosos bits, es decir un código binario: O es apagado y 1 es encendido, por que se trata de un soporte electrónico electrónico. La información biológica se guarda en cuatro "bases nitrogenadas" basadas en química de carbono: adenina; uracilo; citosina y guanina. La unidad de información informática es el octeto, conocido como byte, es decir, una combinación de ocho elementos, ceros y unos. La unidad biológica es el triplete, es decir, combinaciones de tres bases nitrogenadas. Si hacéis un poco de cálculo os daréis cuenta que un byte tiene 256 combinaciones posibles (2x2x2x2x2x2x2x2 = 256). Es decir, que 256 octetos nos sirven para tener el alfabeto latino, todos los signos de puntuación e incluso comandos. Cuando en 1963 los informáticos eligieron este código lo pensaron de la siguiente manera: con dos dígitos puedo representar 22 caracteres, es decir 4 caracteres, con tres dígitos 23 caracteres. Para 120 caracteres, 27 =128. Al final se decidieron por un código basado en 8 dígitos ya que 28 = 256 y así podían representar las letras del alfabeto latino, el griego, minúsculas y mayúsculas, los números y distintos comandos... se olvidaron de asignar un byte de 8 dígito para nuestra letra Ñ. De esta manera, el código binario de apagados y encendidos podía codificar todos los símbolos que necesitamos. En el caso del ARN lo que la selección natural benefició fue...

Un código degenerado

El código genético tiene 64 combinaciones posibles (4x4x4 = 64). El código genético codifica para 20 aminoácidos que son los elementos con los que se construyen las proteínas, las proteínas son cadenas de aminoácidos. Además el código tiene un triplete para comenzar la lectura y tres tripletes para finalizar la lectura. El código tiene cuatro letras: A, G, C y U, que se agrupan de tres de en tres. Esto da lugar a 64 combinaciones diferentes (4x4x4). Sin embargo sólo hay 20 aminoácidos diferentes que están en las proteínas. Del código genético se dice que es "degenerado" porque varios codones sirven para especificar un mismo aminoácido.

Fig. 2. Este gráfico consta de 4 colores que representan las cuatro propiedades químicas que tienen los aminoácidos. Así, los aminoácidos pueden ser ácidos (rosa), básicos (morado), neutros (verdes) o hidrofóbicos (amarillos). Se intuye que existe una conexión, unos lazos "familiares" entre el código ARN y el código químico exhibido por las propiedades químicas de estos veinte aminoácidos. Los aminoácidos además de propiedades químicas también tienen distintos tamaños, así tenemos al aminoácido más pequeño, la glicina y tenemos aminoácidos grandes como la arginina o el triptófano.

Gracias a este código, los ribozimas pudieron traducir su información basada en 4 nucleótidos a un código de 20 aminoácidos. ¿Qué ventaja tienen los aminoácidos frente a los nucleótidos? bien, primero hay aminoácidos de tamaño pequeño y de tamaño grande. Los hay ácidos, básicos, hidrofílicos de carga neutra e hidrofílicos. Por lo tanto el código es ahora más versátil. 

Cada tres bases del ARNm especifican un aminoácido

Un triplete o codón es una secuencia de tres nucleótidos del ARNm, secuencia que determina la formación de un aminoácido específico. Teniendo en cuenta que existen cuatro ribonucleótidos diferentes (U, C, A y G), hay 64 tripletes distintos.

Un mismo aminoácido puede ser codificado por diferentes tripletes

Existen 64 tripletes distintos y hay solamente 20 aminoácidos diferentes, por lo que codones diferentes determinan el mismo aminoácido. A esto se le llama degeneración del código genético. Los codones que especifican el mismo aminoácido se denominan sinónimos.

Como consecuencia de la degeneración del código genético, muchas mutaciones en la tercera base de un codón son fenotípicamente silentes, es decir, el codón mutado especifica el mismo aminoácido que el codón normal.

Los tripletes no se solapan

Cada codón es una secuencia de ribonucleótidos, y no comparte ninguno de ellos con los codones adyacentes en la cadena de ARNm. Por ejemplo: La secuencia 5´AUGCCGUAUGUGUUUUAA 3´ sería 5´AUG CCG UAU GUG UUU UAA 3´

La lectura del código es continua, sin interrupciones

Cualquier pérdida o ganancia de un sólo ribonucleótido produce a partir de ese punto un cambio en todos los aminoácidos desde el lugar de la alteración. El código genético actual ha podido evolucionar desde otros códigos mas simples, pero en éstos códigos los nucleótidos también tuvieron que leerse de tres en tres, ya que, de no ser así, el cambio en la pauta de lectura habría "destruido" la información genética que se había ido acumulando.


Fig. 3. Código genético. Cada tres nucleótidos tenemos un aminoácido. Por ejemplo, AUG codificaría para el aminoácido metionina, CAU codificaría para el aminoácido histidina. El triplete CAC también codificaría para histidina dado que se trata de un código degenerado. El asterisco rojo señala el triplete AUG que codifica para el aminoácido Metionina así como para señalar al primer triplete de la secuencia. Los tripletes UAA, UAG y UGA no codifican para aminoácidos y significan que se ha acabado la secuencia que se va a traducir a aminoácidos. Los colores hacen mención a las cuatro distintas propiedades químicas que exhiben estos veinte aminoácidos: rojo para los aminoácidos con propiedades ácidas, azul los aminoácidos básicos, amarillos para los aminoácidos hidrófilos neutros y verde para los aminoácidos hidrofóbicos. Ahora, el código de cuatro nucleótidos puede tener distintos tamaños de aminoácidos y además cuatro propiedades químicas que expanden el significado químico de la información genética.

PROBLEMA 1: Imaginemos una secuencia de ARN 5´AUGAAACAUGUACGUCGCAUACGACAAUAA 3´ Las secuencias de ARN se leen de 5´a 3´. ¿Puedes traducirla a aminoácidos? ¿Cuáles serían las propiedades químicas de esos aminoácidos?

Solución: Nt Metionina Lisina Histidina Valina Arginina Arginina Isoleucina Arginina Glutamina ct (Habréis notado que en el ARN señalamos los extremos con 5´y 3´mientras que con las proteínas hablamos de Nt y Ct). Las propiedades químicas de principio a final serían, primer aminoácido Metionina= Hidrofóbico, segundo aminoácido lisina = básico, tercero básisico, cuarto hidrofóbico, quinto básico, sexto básico, séptimo hidrofóbico, octavo hidrofóbico, noveno básico y décimo aminoácido hidrofílico neutro. 

Más ejercicios resueltos

La evolución del código informático es tan similar que debemos recordarlo. Los pioneros de la computación escribían su código en código máquina, esto es, en ceros y unos. La forma que tenían para escribir este código en un soporte que pudiese ser leído por las computadoras eran las tarjetas perforadas.

Fig. 4. Tarjeta perforada en formato binario que contiene un programa w: IBM 1130. Estas tarjetas, o un mazo de estas tarjetas se colocaban en una tolva de entrada y el computador las leía una a una. De esa manera, el disco duro, que eran las tarjetas perforadas, pasaba a la memoria temporal o memoria RAM de la computadora. Fuente: Arnold Reinhold

Para un humano, escribir en ceros y unos no es intuitivo, por lo que pronto, los informáticos desarrollaron los lenguajes ensambladores como un intento de sustituir el código de ceros y unos en un código basado en comandos escritos en palabras usando nuestro alfabeto. 

Como un computador puede interpretar y ejecutar sólo el código máquina basado en ceros (apagado del procesador) y unos (encendido), existen programas especiales, denominados traductores, que traducen programas escritos en un lenguaje de programación al lenguaje máquina de la computadora. En el caso del código genético, el código "máquina" basado en secuencias de ARN, con su código de adenina, citosina, guanina y uracilo, se traduce a proteínas basadas en los 20 aminoácidos mediante un traductor llamado ribosoma.

Video 2: Protein Synthesis Animation Video. Fuente: Study Force 

Video 3: mRNA Translation (Advanced). Fuente: DNA Learning Center

El código es aplicable a todos los organismos de la tierra

Esto significa que un triplete determinado producirá siempre el mismo aminoácido, en cualquier organismo. Esto es así por que todos los seres vivos del planeta, y me refiero a virus, bacterias, protozoos, hongos, vegetales y animales procedemos de un único antepasado. Una estructura de ARN con capacidad de traducir su información a un código de aminoácidos. Esta estructura surgió por evolución y tuvo tanto éxito que todos somos sus descendientes. Todos los seres vivos estamos emparentados. Por ese motivo, un gen humano puede ser leído en una bacteria, o un virus puede hacer que su ARN sea leído en una célula humana. Esto es la base de la ingeniería genética. 

Hay una excepción a esta universalidad: el código genético mitocondrial es diferente en algunos organismos, de manera que los aminoácidos determinados por el mismo triplete o codón son diferentes en el núcleo y en la mitocondria.

¿Por que esa estructura de ARN que podía traducir a su código es nuestro antepasado?

Por que tuvo éxito al desarrollar una cubierta proteica que le hizo poder salir del barro para conquistar todo el planeta. Todos los seres vivos procedemos del mismo ribozima, el que desarrolló el ribosoma que le permitió sintetizar proteínas con las que protegerse y abandonar la seguridad de las capas del barro húmedo.

A los ribozimas que vivían entre las capas de las arcillas y podían traducir su código de ARN a un código de aminoácidos gracias a una máquina molecular llamada ribosoma se les llama protovirus: virus ARN con cubierta proteica y ribosoma.

Fig. 5. 

Se ha descubierto recientemente en Brasil unos virus, los tupanvirus, que conservan parte de un ribosoma ancestral. Los protovirus ancestrales constaban de ARN y una cápside proteica que los protegía. Cuando se replicaban, es decir, hacían copias de si mismos, la cápside se desarmaba y el ARN hacía copias de si mismo mediante la ARN polimerasa. Esto sucedía en la sopa biológica ancestral. En esta sopa ancestral abundaban libremente azúcares, pequeños lípidos, aminoácidos y nucleótidos.

Video 4. Self assembling virus. Fuente: Arthur Olson

Y es en esta sopa biológica donde los protovirus vivían felices haciendo lo que más nos gusta a los seres vivos: reproducirnos, demostrarle al mundo que nuestro relato si merece la pena y que tenemos que producir muchas copias, más copias que nuestros vecinos y prevalecer en la cuarta dimensión que es la del tiempo. Pero, como todas las situaciones felices siempre viene alguien a estropear la fiesta.

¿Cómo surge un supervirus por recombinación de dos virus? 

La tragedia para los protovirus ya se venía mascando desde hacía tiempo. En ese paraíso que era un planeta con océanos y ríos ricos en moléculas orgánicas los protovirus solo debían de replicarse. Esto planteaba un problema: para dividir su ARN los protovirus debían desemsamblar su cubierta proteica y copiar su ARN, luego, los ribosomas traducían parte de su información para hacer las proteínas de la cápside que se autoensamblaban porque estaban hechas de aminoácidos complementarios, en forma y en cargas eléctricas. 

Esto planteaba un problema: su ARN estaba desnudo, rodeado de otros ARNs desnudos... y claro, tanta desnudez llevaba a cierta concupiscencia genética. El resultado: protovirus recombinantes, es decir, producto del entrecruzamiento genético entre protovirus similares. Esto que aquí cuento es algo que todavía existe y ocurre. ¿Acaso no habéis leído que el SARS-CoV-2 que ha causado la pandemia del Covid-19 es un supervirus que surgió por la recombinación entre un virus humano y virus de murciélago? El mecanismo por el que aparecen supervirus es muy similar a lo que ocurría cuando no había células y los protovirus vivían replicándose en la sopa biológica. 

Fig. 6. Cuando dos virus, en el interior de una célula o antiguamente, dos protovirus en la sopa biológica, se replicaban tenían que desnudarse. Si dos virus distintos comparten el mismo espacio pueden recombinar y el virus recombinante encapsidarse con lo que tendríamos un virus mosaico de los dos virus precedentes. Normalmente, los virus productos de este tipo de recombinación suelen originar   supervirus como ha sido el caso del SARS-CoV-2

El problema de que encapsides ARN de otro virus que no sea el tuyo te hace un poco ser un virus cachón. Y eso es un problema, en las novelas venezolanas y también en el mundo de los protovirus. Normalmente los virus cachudos o recombinantes suelen ser supervirus responsables de pandemias.

Otro de los problemas que tenían estos virus de ARN era que el ARN es un buen soporte de información, pero de repente aparición un soporte mejor: el ADN. El ADN es similar al ARN de doble cadena solo que su azúcar está menos oxidado, y como sabemos el oxígeno es muy reactivo, por lo tanto, que la molécula soporte de la información esté menos oxidada la hace más resistente. Esto era bueno para virus muy grandes que ya tenían una información valiosa que merecía conservar y que no sufriese tantas mutaciones. Además, una de las bases, la timina, sustituía al uracilo del ARN. La timina es similar al uracilo solo que es un poco más grande ya que tiene un grupo metilo extra. Esto hace que la molécula de ADN sea más rígida que el ARN y por tanto más compacta y menos expuesta a rupturas.

En los tiempos en los que solo había ribozimas y protovirus, éstos ya fueron capaces de desarrollar protovirus de ARN y protovirus ADN. Ahora, la información genética tenía un soporte que era capaz de resistir de manera más eficaz a las mutaciones. Esto permitía que los protovirus de ADN fuesen cada vez más ricos en información. 

Y en esto que aparecieron los primeros organismos biológicos basados no en una cubierta proteica, sino en una envoltura grasa: la membrana formada por una bicapa lipídica. En ese momento, la vida se dividió en dos clasificaciones: Acytotas constituídos por los protovirus y Cytota formado por las nuevas estructuras con bicapa lipídica que serían similares a las arqueobacterias actuales. El prefijo "Arqueo-" significa "antiguo, arcaico, primitivo" y procede del griego "archaio"

Fig. 7. A en un mundo sin células los protovirus (virus de ARN, cápside proteica y ribosomas) vivían felizmente B Solo tenían que abrir su cápside y sus ribosomas comienzan a traducir su información en proteínas. C Cuando aparecen las arqueobacterias el primer efecto fue acaparar toda la sopa biológica, todas las ricas moléculas orgánicas que hasta ese entonces habían estado libres. Los protovirus tuvieron que ingeniárselas para invadir el interior de las células y tomar lo que hasta aquel entonces había sido suyo. El resultado del problema 2, más abajo, explica como en D hoy en día ya no tenemos prácticamente protovirus (excepto los tupanvirus) sino virus, sin ribosomas, porque utilizan el ribosoma de la célula en la que se repliquen. Por lo demás, puede haberlos parásitos de células de eubacterias, de eucariotas, con cápside y membrana o solo con cápside, de ARN o de ADN.

¿Qué ventaja tiene una membrana plasmática frente a una cápside proteica? Dos grandes ventajas, por un lado son capaces de almacenar los nutrientes que antes estaban libres y dos en las células con membrana plasmática el ADN nunca está fuera de la célula y por tanto es difícil que su ADN sufra recombinaciones indeseadas y que "Luis Alfredo" sea hijo de quien tiene que ser y no del lechero.

Cuando apareció las primeras células, las arqueobacterias, con una membrana lipídica que les permitía duplicar su material genético dentro de una barrera, su membrana, todo cambió. Las bacterias primitivas comenzaron a crecer masivamente. La mayoría de las sustancias orgánicas que conformaban la sopa biológica pasaron al interior del citoplasma de las nuevas entidades biológicas.

Los protovirus estaban quedando sin su hábitat natural ¿A dónde se iban los nutrientes? bien, los nutrientes estaban siendo secuestrados en el interior de las arqueobacterias, así que los virus que fueron capaces de entrar en el interior de las arqueobacterias se encontraron con la sopa biológica que se les estaba robando. Y comenzaron a entrar y salir de las arqueobacterias. Entraban para poder dividirse en la sopa biología del citoplasma bacteriano, salían para buscar nuevas arqueobacterias. En esto apareció un protovirus mutante, un protovirus que carecía de los genes que codificaban para los ribosomas, por tanto, se dividían más rápido. ¿Es esto importante? lo vamos a ver

PROBLEMA 2: Cuando no existían bacterias toda la vida sobre la Tierra era vírica. Eran protovirus de ARN que tenían ribosomas. Estos virus se replicaban en la sopa biológica (en Ecuador en el locro biológico). Cuando aparecieron las bacterias, éstas tenían una membrana que diferenciaba fuera de dentro. Las bacterias metieron dentro todo lo que les interesaba de la sopa biológica. Los protovirus al quedarse sin su alimento sufrieron una presión selectiva que favoreció a aquellos virus que sabían como penetrar en el interior de las bacterias y alimentarse de lo que antaño había sido suyo. Nacieron los virus como entidades parásitas de las células. Muchos biólogos siguen diciendo, de forma equivocada, que los virus no son entidades vivas porque se tienen que alimentar de una célula metabólicamente activa. Si es por eso, podríamos incluir en la categoría de virus a muchas personas que no son capaces de subsistir sin su tarjeta de crédito. ¿Cómo perdieron los protovirus sus ribosomas? porque hoy en día los virus actuales no tienen ribosomas. Como siempre la solución está en la selección natural. Imaginemos dos virus A y B. El virus A es un protovirus, tiene ribosomas, y su ARN tiene 60.000 bases. El virus B perdió los genes de los ribosomas y por esa razón tienen 40.000 bases. No necesita codificar ribosomas porque puede utilizar los de la bacteria que infecta. Ambos virus infectan y se replican en el interior de bacterias. Si la ARN polimerasa copia a una velocidad de 1000 bases por minuto, y en los cromosomas de A y B existe un solo ORI. ¿Cuánto tiempo tarda cada virus en replicarse? ¿Cuánta descendencia tendrá cada virus al cabo de seis horas?

Solución: Virus A 30 minutos virus B 20 minutos. En 6 horas tendremos de A  4096 virus, y de B tendremos 262144. Si en vez de horas hablásemos de miles de años podemos entender porqué los virus actuales carecen de ribosomas.

Como vemos en el problema 2, en biología, el que se reproduce mantiene su discurso genético, su información hereditaria en la cuarta dimensión. Los que no se reproducen son flor de un día y desaparecen de la línea de tiempo.