sábado, 28 de mayo de 2022

"El poder de uno necesita la estupidez del otro"

Entrada dedicada a mi hijo Antón

Las bases de la vida que hemos visto hasta ahora contemplan varios mecanismos. Primeramente, la evolución se basa en la selección natural de aquellas entidades autorreplicantes que llamamos seres vivos. Aquellos con capacidad para pasar su descendencia a la siguiente generación, bien por que se repliquen más rápido, o por que se las ingenien para conquistar nuevos territorios, son las que prevalecerán y desplazarán a las que tengan menos capacidad. Es una evolución basada en la competición. El siguiente mecanismo es la evolución basada en relaciones parasíticas. El territorio de él se produce a expensas del yo. El yo intenta evitar la invasión, la colonización con mecanismos inmunológicos que buscan preservar la única identidad del territorio del individuo, que hasta ahora es la célula, ya que todavía no han aparecido en la Tierra los organismos pluricelulares. Cuando la coevolución del parásito y el hospedador es muy estrecha, los dos organismos, él y yo, acaban por pactar, por ceder, por negociar, por aceptar un centro de decisión común. Ganan ambos al desarrollar una estructura biológica más sofisticada pero cada uno de ellos pierde autonomía e identidad. Es el proceso de mestizaje que puede ser muy doloroso como bien saben en América Latina. A nivel biológico el mejor y más exitoso ejemplo de mestizaje o de simbiosis es la aparición de la célula eucariota. De eso tratará el siguiente capítulo. Pero antes, tenemos que deleitarnos con un nuevo mecanismo por el cual la vida se organiza. Un mecanismo que fue desarrollado por las bacterias. En concreto, una de esas bacterias sociales, Myxococcus xanthus, es la que los científicos emplean para descifrar un mecanismo que podríamos denominar "El poder de uno necesita la estupidez del otro". Esta frase pertenece al pastor luterano Dietrich Bonhoeffer 


Un principio de este mecanismo es la multicelularidad, es decir, que exista un número alto de clones. Esto es novedoso porque para que la evolución basada en la competición ocurra tenemos que tener una población diversa. La diversidad genética es básica, bien por mutaciones, por recombinaciones, por sexo. La selección natural ocurre sobre una población diversa. El mecanismo "El poder de uno necesita la estupidez del otro" se genera a partir de la uniformidad de múltiples individuos

Fig. 1. Evolución por la estupidez del otro. Un célula, a la izquierda, se reproduce hasta formar un conglomerado clónico. De repente, por un mecanismo que todavía se está desentrañando, una de esas células se convierte en él, célula en rojo, y a partir de ese momento, yo y todas las que son como yo, células azules, vamos a trabajar para él.

Este es el mecanismo que desarrolla Myxococcus xanthus en situaciones de estrés alimenticio. El protozoo eucariota Dyctiostelium discoideum, también lo emplea. Lo emplean los insectos sociales de la clase himenóptera como hormigas, termitas, abejas y avispas. Lo emplean las ratas topos. Y lo más asombroso... todos los seres pluricelulares utilizan este mecanismo... si, los seres humanos también. Lo que voy a contar a continuación va a cambiarte la forma en que, estimado lector, te ves a ti mismo.

En los animales sociales se entiende bien. Todos los animales de la colonia proceden de una hembra reina. Pongamos por ejemplo las ratas topo. Solo la reina tiene descendencia, el resto de las ratas son estériles y trabajan en pro de la descendencia de la rata reina. La reina tiene altos niveles de hormonas en su orina que esterilizan a las demás ratas hembras. Si la rata reina se muere, las hormonas empiezan a desaparecer de los túneles de la colonia, al desaparecer la hormona esterilizante las hembras recobran poco a poco su fertilidad, con ella su capacidad de producir hormonas esterilizantes que van a liberar con su orina. La primera hembra en generar capacidad para producir grandes cantidades que esterilicen a las otras se convertirá en la nueva reina de la colonia. 

En los organismos pluricelulares como el ser humano, cuando el óvulo fecundado comienza a dividirse, va a formar una mórula, un pequeño agregado de células 2n clónicas. Es en ese momento cuando una célula de esa mórula se convierte en él, y el resto de las células van a trabajar para él el resto de su vida. A él le llamamos célula sexual y las demás células se les llamará células somáticas. Lo que conocemos por el yo biológico no somos más que células somáticas.

La biología, sobre todo la evolutiva, así como la historia, son disciplinas que entienden que los procesos se producen en tres dimensiones y también en una cuarta dimensión que es el tiempo. Cuando les pregunto a mis alumnos ¿Dónde estarás tu en 2100? la respuesta es: ¡Muerto!. Si, posiblemente estés muerto. Biológicamente es posible que estés vivo si has sido capaz de encontrarle a tus óvulos o a tus espermatozoides un background genético para que ellos sigan sobre la Tierra cuando tu ya no estés. No solamente heredas tu ADN, también tus valores y tus ideas. Es algo que se aprende cuando estudias biología o historia: a tener una sensibilidad por la cuarta dimensión que es el tiempo. 

El yo, en este caso Esteban Fernández Moreira, es un cadaver andante. Todo lo que veís acabará en un traje de madera. Solo dos de sus células sexuales han tenido la fortuna de pasar a la siguiente generación. Se trata de los dos espermatozoides a los que tuve que procurar un óvulo. A partir de ahí, el 50% genético de Flavia y Antón que
 procede de mi, tendrá que buscar cómo pasar su ADN a la siguiente generación, que serán mis nietos. 

El nacimiento del cadáver

En el catálogo de Netflix abundan las series sobre gurús que mediante técnicas básicas de control mental han conseguido enriquecerse y manipular a cientos de personas. Es muy interesante observar el estupor de los ex adeptos cuando narran cómo se comportaban cuando estaban dentro de la secta. Es un patrón general. Cuando se liberan de la secta odian al gurú, cuando estaban en ella lo amaban. La diferencia entre un estado y otro es que dentro de la secta se regían por una serie de normas muy estudiadas, lo que se llama control mental, y cuando estas normas desaparecen, por ejemplo porque alguien los desprograma, como cuando la policía irrumpe y desbarata la secta, en ese momento, es como si despertasen de un sueño y es ahí cuando comienzan a regresar a su vida anterior. Este es un patrón de abuso que se refleja en muchos de los cuentos populares en los que el protagonista en un momento de la historia está "hechizado" bajo el poder de alguien que lo utiliza para sus propios fines. Es el caso del cuento "La Reina de las Nieves" de Andersen.

En estas páginas no trato de hablar de microbiología. Trato de reflexionar sobre de dónde venimos, quiénes somos y a dónde vamos, desde una perspectiva biológica. La biología, lo mismo que la historia, la linguística... tiene muy presente el impacto de la cuarta dimensión: el tiempo, en todos los procesos. Nuestro material hereditario está esculpido por el tiempo. Las personas que estudian embriología suelen decir: la ontogenia, es decir, el desarrollo del embrión, recapitula la filogenia, es decir, durante el desarrolo del embrión se puede ver como pasamos por todos los estados previos: protozoo, mórula, gusano, reptil, mamífero y finalmente alcanzamos aquellas características que nos definen como humanos.

Tendemos a vivir sin tener noción real del tiempo. Nacemos y en nuestros primeros años el cerebro se va amoblando con las enseñanzas de nuestros padres, luego la escuela, los amigos. Llega un momento en que nos vemos adultos e inmortales, sin saber, que somos un eslabón en una cadena, un parpadeo. Absorbemos como esponjas aquello que nos enseñan nuestros padres los primeros años porque estamos ansiosos de ser mayores, de independizarnos. Al absorber perdemos identidad. Es en la adolescencia en donde ponemos en tela de juicio aquello que absorbimos y dimos por bueno. Con la vejez nos damos cuenta de que la mayoría de nuestra experiencia y de nuestras historias son irrelevantes. Con suerte todo se puede resumir en un párrafo, quizás, si nuestra vida ha sido plena, un par de carillas. Algunos ancianos esta realidad les permite distinguir con mayor claridad lo que está bien de lo que está mal. Por eso mismo, en la antiguedad, siempre había un consejo de ancianos y la voz de los mayores era respetada. Asumimos que los ancianos son más propensos a decir la verdad de una manera instintiva. Lo mismo que cuando somos niños no somos capaces de sospechar que quizás nuestros padres sean unos gilipollas. 

Lo que nos cuentan de niños, porque es la primera vez que lo escuchamos, y lo que escuchamos de los viejos porque quizás sea la última vez que lo escuchamos, tienen en nosotros un peso especial. Por eso recuerdo a mi abuelo Antonio cuando me contaba una anécdota que le había sucedido en Brasil. Se estaba quemando el bosque de una isla y cinco monos trataban de huir. Formaron una cadena y empezaron a hacer que esa cadena oscilase. Cuando tuvieron suficiente impulso, el mono que estaba más abajo saltó y logró atravesar el río, el siguiente mono que estaba más abajo haciendo que la cadena oscilase más fuerte fue capaz de saltar y ponerse a salvo en la otra orilla. Los otros tres monos vieron que carecían de impulso, por eso no saltaron y evitaron ahogarse en el río. Mi abuelo no contaba que había pasado con los tres monos que no pudieron ponerse a salvo, aunque el final trágico se adivinaba. 

Un territorio en peligro, cinco monos, tres se sacrifican para que dos puedan huir. Tradicionalmente, los microbiólogos nos hemos dedicado a investigar moléculas. Eso ha moldeado el discurso científico, todo tiene que ser explicado en función de relaciones moleculares. Cuando estas relaciones son sencillas y evidentes, como en el caso de los sistemas toxina-antitoxina, nuestro entendimiento es claro. Cuando tratamos con realidades más complejas, o con conceptos más abstractos como el territorio, el tiempo... ahí, el excesivo reduccionismo de la biología molecular no nos deja entender realmente qué está ocurriendo. 

Como trabajar con monos es complicado, hacerlo con bacterias es más sencillo. La bacteria social Myxococcus xanthus es una bacteria modelo y lo es gracias a su ciclo celular que consta de cuatro estadíos a saber: 

 Fig. 2. Ciclo vital de Myxococcus xanthusEn el estadío 1, la bacteria crece por división binaria como lo hacen todas las bacterias, de una se divide en dos, esas dos en cuatro... cada bacteria lleva una existencia individual. Este estadío es el que tiene lugar cuando hay abundancia de alimento. Cuando el alimento comienza a escasear, M. xanthus se agrupa en lo que se viene a llamar una "manada de lobos" 2. En este estadío M. xanthus forma un enjambre de células que van perseguir a bacterias de otras especies para rodearlas y eliminarlas mediante enzimas hidrolíticas para luego alimentarse de sus restos. Cuando la comida comienza a escasear de veras y ya no compensa hacer expediciones en busca de comida, las bacterias comienzan a formar un pedestal. En el tope de ese pedestal una serie de bacterias se van a convertir en esporas. Esas esporas se van a dispersar y si por casualidad una de ellas aterriza en un lugar en donde hay abundante alimento, la espora germina, es decir se abre, y de ella surge una nueva célula de Myxococcus. 

Si observamos la Fig. 2 tiene muchas similitudes con la Fig. 1. ¿Sabrías encontrar estas similitudes?

Las células sexuales, las que van a prevalecer en el tiempo van a disfrutar de este oportunidad a expensas de células que son exactamente igual que ellas y que se van a sacrificar en aras de la capacidad que tienen esas células de sobrevivirles. Este esquema es el que tiene también el ciclo vital de los humanos. A esas células rojas, egoistas, les llamamos células sexuales. Aunque esas células provienen del mismo zigoto que las somáticas, habrán pasado por dos procesos que las convierten genéticamente distintas a las somáticas: la segregación cromosómica y la recombinación. Pero hablaremos de esto más adelante.

Fig. 3. Ciclo celular de los humanos. Estadío 1, las células sexuales, las únicas que van a tener la oportunidad de continuar vivas en el tiempo, están repartidas en dos sexos. La célula sexual masculina nadará hacia el óvulo y al fecundarlo ese óvulo se convertirá en un zigoto, estadío 2, con una dotación cromosómica doble, la proveniente del espermatozoide y la del óvulo. El zigoto comienza a dividirse y cuando llega al estadío mórula, se diferencias aquellas células que van a dar lugar al linaje sexual, en rojo, de las que van a ser somáticas, es decir, células que no van a tener oportunidad de continuar vivas en el tiempo

El poder de las células rojas sobre las azules necesita que sean homogeneas, especializadas y estúpidas para poder manipularlas. Ambientes y territorios complejos necesitan estrategias complejas.

viernes, 27 de mayo de 2022

Comparar el tocino con la velocidad

 Mi amigo David Ortega me señala el siguiente video sobre organismos modificados genéticamente (en sus siglas OMG) por la calidad de los gráficos:

¿Los transgénicos son buenos o malos? La ingeniería genética y la comida

Ahí va mi análisis:

1 ¿Ciencia o tecnología?

En el video habla de científicos, y es cierto, muchos científicos han trabajado desarrollando esta tecnología, pero... los que trabajan para las compañías que venden los OMG no son científicos, son tecnólogos. Es parecido pero diferente. El científico comparte de manera pública sus trabajos. El tecnólogo trabaja para una compañía y su trabajo está protegido con una patente. 

Una de las características de la ciencia es que es que genera conocimiento público. En la película "Ágora" de Alejandro Amenabar, sobre la matemática griega que vivía en Alejandría, y que fue asesinada por una turba enfurecida, se muestra de manera sesgada como la barbarie puede acabar con la vida de alguien notable, Hipatía, sino también con el repositorio más importante del saber de aquella época como era la Biblioteca de Alejandría. La película tiene un sesgo a favor de Hipatía claro, sin embargo, lo que la película no cuenta es que aquella biblioteca y aquel conocimiento estaba vedado para gran parte del pueblo que eran esclavos. Ese pueblo de esclavos se rebela contra los amos y quema la biblioteca que para ellos no era más que un símbolo de la opresión en la que vivían. La lección de todo esto es que o el conocimiento es público o al final será destruído por aquellos que viven sometidos por este mismo conocimiento. 

La ciencia procura el avance del conocimiento y es pública, la tecnología procura mejorar el margen de beneficios de aquel que invierte en ella (lo cual es perfectamente legítimo), pero hay que aclarar este punto. Sonia Contreras, experta en nanotecnología que trabaja en Oxford, nos lo aclara en esta entrevista: “La gente reaccionará contra los abusos de la tecnología y acabará con la ciencia

2 La estupidez no es un defecto intelectual sino moral

Hace años, participaba en un evento de divulgación científica. Me tocó al lado una estudiante de biotecnología... ella sostenía que "para ella" ciencia y tecnología eran lo mismo. Pongo entre comillas porque el único argumento que utilizó fue precisamente ese, que era su opinión. Dietrich Bonhoeffer, en su teoría de la estupidez dice que la estupidez no es una carencia intelectual sino moral. Si consideramos que este concepto es cierto, no ganamos nada haciendo divulgación científica. Si la persona está convencida de antemano de algo... por mucho que nos esforcemos no vamos a conseguir que se aparte del grupo al que se ha adscrito. Es como los antivacunas. Es más efectivo prohibir a los que no están vacunados el acceso al centro comercial al no tener el carnet de vacunación que tratar de convencerlos. 

Si una persona no tiene conocimientos técnicos para evaluar una técnica no debe de ser consultada. La pregunta es ¿Tiene esa persona capacidad para distinguir el bien del mal? Ahí es donde entra el primer punto. Hasta hace poco, los científicos estaban considerados un referente ético social. En las novelas de Julio Verne se refleja esa confianza en el conocimiento. Cuando aparece la tecnología unida a desarrollos militares, o a grandes corporaciones que se mueven por ánimo de lucro... el valor ético de este conocimiento se empieza a resquebrajar. Por eso, antes que divulgar los conocimientos técnicos con la vacua esperanza de que así la ciudadanía pueda tener una opinión fundamentada, sería más correcto que aprendiesen a distinguir qué instituciones están encargadas de evaluar el bien común en este tipo de asuntos. Es una tarea difícil porque todas las instituciones están bajo sospecha de haber sido sobornadas. 

No es twitter el que debe de elegir sobre temas importantes, son las instituciones que nosotros hemos decidido que deben encargarse de decidir sobre el bien común. Ni siquiera un presidente, y estoy pensando en D. Trump, debería de tener el poder de decidir sobre temas técnicos que no domina.

La buena divulgación debe de ir a contracorriente del marketing y decirle a la gente: tu opinión importa una mierda :) Pero bueno, paz y amor. También estaría fantástico explicarles que las OMG son buenas y que además hacen ganar dinero a quienes los producen, que aquellos que invierten en tecnología tienen derecho a ganarse el dinero. No pasa nada por dejar este punto claro. 

3 ¿Quién asume el riesgo?

El video es falaz porque cae en la falacia de las verdades a medias. Es un truco antiguo y barato. ¿Qué tiene que ver los OMG y el granizo, o las sequías? nada ¿Verdad? Es como comparar el tocino con la velocidad. Pues bien, el problema de depender de semillas OMG es que cada año hay que comprarlas al proveedor, para comprarlas pides un crédito. Hasta ahí todo bien. Todo está pensado para que el agricultor gane dinero, la compañía de las OMG gane dinero y por supuesto el banco. Ahora bien ¿Si cae una granizada? ¿Si hay una sequía y la cosecha se agosta? ¿Quién asume el riesgo? Deja tu respuesta en los comentarios

Una de las grandes potencias que tienen los agricultores es poder utilizar una parte de la cosecha para resembrar al año siguiente. Las semillas modificadas genéticamente tienen que ser compradas cada año a la empresa que las produce, por lo tanto, obliga a los agricultores a pedir un crédito para comprarlas, crédito que se pagará con los beneficios de la cosecha. Si la cosecha es mala entonces el crédito no se paga y los plazos y los intereses se alargan. Esto ya lo vivieron los agricultores con el maíz híbrido, que es un maíz que por sus características genéticas no se puede replantar.

  

lunes, 16 de mayo de 2022

O mía o de nadie

Las relaciones entre individuos se pueden resumir, como hemos visto, en competitivas, parasíticas y simbióticas. Las relaciones competitivas nos son fáciles de entender. Se basan en el egoísmo, "quítate tu pa ponerme yo". Adam Smith, intuyó que entender el interés personal de un compañero podría llegar a un intercambio mútuamente beneficioso bajo la premisa "dame lo que necesito y tendrás lo que deseas". Es decir, las relaciones competitivas no solo generan egoísmo en las relaciones. Las relaciones parasíticas tampoco es una depredación de recursos y una manipulación sin nada a cambio, en muchos casos. Estamos empenzando a entender estos procesos. En la simbiosis parece que se llega a una relación perfecta donde tu ganas y yo gano... Pero, no se llega a esta situación que en principio parece ideal de una manera cooperativa, altruísta, equilibrada. Un amarre ferreo sella el destino de ambos. Sin este amarre no hay posibilidad de un destino compartido. Ese amarre molecular "o mía o de nadie" lo inventaron los virus con los sistemas toxina-antitoxina.

O mía o de nadie

El egoísmo, la extrema hijoputez, es ligar un territorio a ti de manera indisoluble. El machista quiere que su mujer le pertenezca de manera que la única forma de librarse de ellos sea con los pies por delante. O la madre posesiva que prefiere ver a su hija muerta antes que de otro. Los virus inventaron este egoísmo de una manera elegante. En su genoma llevan dos genes: uno codifica para una toxina, o un veneno, como quiera decirse. El otro gen es un antídoto que anula la actividad tóxica del veneno. El truco está en que la molécula del antídoto es lábil, es decir, se deteriora rápidamente. Tiene que estar produciéndose constantemente para anular a la toxina. 

Fig. 1. Si una bacteria es portadora de ADN vírico egoísta, compuesto de un gen de toxina y otro antídoto, va a producir toxina y su antídoto. Si, al dividirse la bacteria, una hija (b) lleva el ADN vírico egoísta va a seguir produciendo toxina y antídoto, con lo cual la bacteria puede vivir su vida tranquilamente (d). Si al dividirse una de las hijas (c) carece de ese ADN vírico no va a poder producir nuevas toxinas y lo que es más importante: nuevos antídotos. Como el antídoto es una molécula lábil, de vida media corta, cuando desaparece la toxina todavía está en el interior de la célula y la mata. De esta manera se consuma el "o mía o de nadie". 

Aquí hay un concepto importante que es el de los incentivos que tienen ambas partes para participar en la simbiosis. Algo que recuerda a la teoría de juegos

Cautivos del mal

En la película "Cautivos del mal" de Vicente Minelli, y guión de Charles Schnee, el personaje del productor Shields es un manipulador sin escrúpulos para quien lo esencial es el producto artístico final, tal como él lo concibe, aunque para conseguirlo deba apropiarse de ideas ajenas y rechazar la participación del que parecía su mejor amigo, enamorar a una actriz con la autoestima baja y demasiado pendiente de la botella o alejar (con desastrosas consecuencias) a la entrometida esposa de su exitoso guionista. A pesar del resentimiento frente a Shields tanto el director, como la actriz o el guionistas reconocen que nunca hubiesen alcanzado la fama si no hubiese sido por las malas artes del productor.En la película "Cautivos del mal" de Vicente Minelli, y guión de Charles Schnee, el personaje del productor Shields es un manipulador sin escrúpulos para quien lo esencial es el producto artístico final, tal como él lo concibe, aunque para conseguirlo deba apropiarse de ideas ajenas y rechazar la participación del que parecía su mejor amigo, enamorar a una actriz con la autoestima baja y demasiado pendiente de la botella o alejar (con desastrosas consecuencias) a la entrometida esposa de su exitoso guionista. A pesar del resentimiento frente a Shields tanto el director, como la actriz o el guionistas reconocen que nunca hubiesen alcanzado la fama si no hubiese sido por las malas artes del productor.

Lo que no te mata te hace más fuerte: la viruela dio una ventaja competitiva a los europeos

La viruela y el sarampión fueron una ventaja evolutiva que permitió el éxito y la expansión europea en América. Según el antropólogo Jared Diamond, Pizarro contó con una ayuda microscópica en la batalla de Cajamarca contra fuerzas incas que los superaban en un ratio de 1:50. Según publica en su libro "Gérmenes, armas y acero" el sarampión y la viruela ya habían causado pánico y estragos en la población previamente a la batalla.


¿Por qué los incas eran tan susceptibles a la viruela? La viruela originalmente es un virus de vaca. Cuando las poblaciones de Eurasia comenzaron a domesticar la vaca, el virus comenzó a infectar a las poblaciones humanas. La mayor parte de los europeos que llegaron a América tuvieron los virus en la etapa infantil y pudieron pasar las viriasis en esa etapa, por lo que ya disponían de inmunidad natural protectora. En el caso de los indígenas, la falta de contacto previo supuso una ‘virginidad inmunológica’, una falta de respuesta defensiva frente a las nuevas infecciones y por eso, al infectarse de adultos la mortalidad era tan alta.

Los virus le dan una ventaja competitiva a Pseudomonas aeruginosa

Pseudomonas en principio era una bacteria medioambiental. Vive en todo tipo de lugares, desde piscinas y spas hasta en el jabón desinfectante de hospitales. Por su extraordinaria capacidad metabólica pudo crecer en los ambientes limpios de los hospitales. Al ser los hospitales ambientes en los que los antibióticos están siempre presentes, con el tiempo se seleccionaron cepas resistentes a los antibióticos. Hoy en día, esta bacteria es la principal responsable de las infecciones adquiridas en los hospitales. Recientemente hemos aprendido de que, lo mismo que Pizarro se benefició de su historia evolutiva previa, Pseudomonas también se beneficia de un bacteriófago que antiguamente la parasitaba. Este virus bacteriofago (fago) engaña al sistema inmunitario para que este ignore a la bacteria.


Con los fagos ocurre lo mismo que con el virus del herpes labial que vive insertado en el ADN de nuestras neuronas. Sólo cuando detectan que su hospedador está estresado es cuando deciden salir de la célula que lo alberga. En el caso de los fagos rompiendo desde dentro a la bacteria, en el caso de las neuronas viajando desde el núcleo de la neurona por todo el axón hasta llegar a las células del labio en donde causa un sarpullido lleno de virus que le permite transmitirse a otro hospedador por un beso, un vaso compartido etc.

Video 2: Diferencia entre fagos líticos (los que destruyen a las bacterias) y los lisogénicos (que pueden insertar temporalmente su ADN en el ADN de la bacteria hospedadora). Fuente

La bacteria y el fago, llamado Pf, establecen una relación de simbiosis que se sospecha que está más extendida en el mundo microbiano de lo que se creíaPseudomonas crece en las heridas abiertas de los pacientes de los hospitales. Las Pseudomonas que no tienen en su interior fagos sobreviven menos que aquellas Pseudomonas que si los tienen porque cuando el fago detecta que el sistema inmune ataca a Pseudomonas sale de entre el ADN de la bacteria, hace muchas copias de si mismo, mata a la bacteria y sale por decenas al cuerpo del paciente. Esto hace que el sistema inmunitario se dedique a matar fagos dándole un respiro a las bacterias que pueden seguir colonizando la herida abierta aunque tengan que pagar el peaje de que muchas de ellas revienten por culpa de la proliferación de los fagos. a ir tras él en lugar de hacerlo tras su hospedador. Este hallazgo ha sido publicado el pasado 28 de marzo en Science y ayudaría a explicar por qué el sistema inmunitario tolera las bacterias beneficiosas, como las presentes en el intestino, y podría guiar el diseño de mejores tratamientos para las infecciones.

Heridas abiertas infectadas por bacterias cautivas del mal

Para comprobar si los fagos influyen en el modo en el que las bacterias interactúan con sus huéspedes, el inmunólogo Paul Bollyky, de la Universidad Stanford, recogió muestras de heridas crónicas, como quemaduras infectadas, de 111 personas. De estas muestras, 37 presentaban infección por P. aeruginosa.

Bollyky y sus colaboradores encontraron que el 68 por ciento de las heridas que contenían P. aeruginosa albergaban también el virus Pf. Cuando transfirieron estas bacterias infectadas por el fago a heridas abiertas de ratones, descubrieron que el número de bacterias necesario para iniciar la infección en los roedores era menor y que estos eran más propensos a morir a causa de esas heridas que cuando eran infectados únicamente con la bacteria P. aeruginosa.

Fig. 4. Internalización del fago Pf en una célula de mamífero. La endocitosis de Pf por las células dendríticas y otros leucocitos dispara los receptores de reconocimiento viral, los cuales suprimen la limpieza y eliminación de las bacterias. Esta imagen tridimensional fue generada utilizando microscopía confocal y imágenes apiladas en Z. Púrpura tiñe las fibras de actina, azul el ADN mediante DAPI, el verde es el fluoróforo Alexa Fluor 488 unido a un anticuerpo antiPf4. Fuente

Las bacterias atraían a unas células del sistema inmunitario llamadas fagocitos, los cuales «engullen» a las bacterias pero no a los virus. Los fagocitos intervenían en las heridas infectadas por P. aeuruginosa y Pf y se marchaban poco después de haber engullido unas pocas bacterias. Luego envíaban señales que atraín a otras células del sistema inmunitario encargadas de atacar solo a los virus del área.

Fig. 5. Se logró reducir las infecciones causadas por P. aeuruginosa mediante la vacunación de los ratones contra los Pf, antes de infectarlos con la combinación de bacteria y virus.

Las bacterias que no amaban a los machos

Imagina una bacteria que hubiera infectado a un millón de especies distintas, especializándose en introducirse en lo ovarios y los testículos de sus huéspedes. Imagina también que en ocasiones esa bacteria se dedicase a aniquilar a casi todos los machos y además, como si fuera un arcángel parásito, fuese capaz de provocar embarazos espontáneos en las hembras. Imagina también que, desde su cálido hogar en los genitales de los animales a los que ha infectado, esta bacteria hiciese que dos poblaciones vecinas de una misma especie ya no pudieran aparearse con éxito. Pues bien, esa bacteria existe y se llama Wolbachia, la bacteria parásita más exitosa del mundo capaz de infectar a un millón de especies distintas de invertebrados. La lista de especies va desde mariposas, avispas, moscas, saltamontes, pulgas, termitas, gusanos. No infecta vertebrados, por tanto los humanos estamos libres de esta plaga afortunadamente. Para los playboys piscineros que sueñan en vivir en un harem es una desgracia ya que una vez que Wolbachia infecta una especie esta bacteria es capaz de conseguir que haya hasta 99 hembras por cada macho.

Wolbachia es maestra en el arte de manipular el sexo de las especies que parasita porque necesita a las hembras para perpetuarse. Wolbachia vive dentro de las células de su hospedador de las que nunca sale. ¿Cómo hace para perpetuarse e infectar a otros individuos? Wolbachia ha resuelto este problema infectando los óvulos de las hembras. De esta manera se transmite a los descendientes de las hembras. Los machos son para ella un callejón sin salida porque al ser el espermatozoide tan pequeño no pueden introducirse en el para viajar de los machos a las hembras. Solución: fuera machos. Para eliminar a los machos esta gran manipuladora puede utilizar diferentes estrategias: la más común y más estudiada es la incompatibilidad citoplasmática, que hace que un macho infectado por Wolbachia sólo puede tener descendencia con hembras infectadas (Ver próxima entrada); algunos tipos de Wolbachia feminizan a los machos modificando sus niveles de hormonas de forma que puedan poner huevos; otra estrategia utilizada es matar a los machos cuando estos están en fase de embrión; y por último la partenogénesis en donde la hembra tiene hijos sin necesidad del esperma de un macho.

Los parásitos como Wolbachia encuentran siempre su propio camino para entender la biología de su hospedado y hacer que obedezcan sus órdenes. Es más fácil vivir dentro del cuerpo de un invertebrado que en el cambiante mundo exterior. Los organismos superiores somos más predecibles, sobre todo en cuestión de sexo y por ello más manipulables.
Fig. 2. Fotografía de microscopía de fluorescencia de Wolbachia (verde) en el interior de los testículos de un insecto. En rojo se muestra el esperma. Cortesía Michael Clark y Seth Bordenstein. Las bacterias Wolbachia viven en el interior de las células de los invertebrados infectados, también en el interior de los óvulos de las hembras. En los machos viven también en el interior de los testículos, pero son incapaces de introducirse en el interior de los espermatozoides. De esta manera las hembras infectadas transmiten la bacteria a sus hijos por lo que la bacteria favorece que haya el mayor número de hembras a expensas de los machos que para Wolbachia son un callejón sin salida

Fig. 3. Incompatibilidad citoplasmática. La toxina que produce Wolbachia deforma el ADN de los espermatozoides. Al mismo tiempo en los óvulos secreta un antídoto que corrige esta deformidad. Por eso un macho infectado por Wolbachia sólo puede tener descendencia con una hembra infectada. 

Incompatibilidad citoplasmática: como se ve en el diagrama un macho infectado por Wolbachia sólo puede tener descendencia con hembras infectadas, si este macho infectado copula con una hembra sana su esperma inviable no daría lugar a descendencia. En cambio las hembras infectadas, las que transmiten la bacteria, pueden tener descendencia tanto con machos sanos como con machos infectados. Esta estrategia hace que las hembras sanas estén en inferioridad de condiciones respecto a las hembras colonizadas por Wolbachia. Esta es una de las claves por las que uno de cada cinco insectos es portador de esta bacteria.¿Cómo lo hace Wolbachia? la bacteria secreta una toxina en los testículos que deforma el ADN de los espermatozoides. Al mismo tiempo en los óvulos secreta un antídoto que corrige esta deformidad. Por eso un macho infectado por Wolbachia sólo puede tener descendencia con una hembra infectada.
Fig. 4. Feminización. En algunas especies de Wolbachia permite que nazcan machos, pero altera sus hormonas de manera que los feminiza y los hace capaces de producir huevos. 
Fig. 5. Feminazización. Algunas especies de Wolbachia son capaces de matar a los embriones machos

Fig. 6. Wolbachia es capaz de alterar el estado hormonal de las hembras de manera que los huevos se convierten en embriones sin necesidad del esperma del macho. Todos los embriones fecundados sin esperma se convierten en hembras, las cuales también pueden dar procrear sólo hembras.

Gracias a herramientas como ésta, Wolbachia manipula las poblaciones de sus hospedadores, de manera que en vez de tener poblaciones en donde la mitad son machos y la otra mitad hembras resulta que por cada 99 hembras hay un solo macho. Obviamente cuando se llega a esos extremos las hembras viven una situación de intensa competencia por los machos que como podemos imaginar viven acosados y extenuados.

La carrera de armamentos de Wolbachia y sus hospedadores 

El investigador Greg Hurst del University College de Londres descubrió que la mariposa Hypolimnas bolina la cual tenía una relación de 99 hembras por cada macho, en los años 2005 al 2006 cambió esta relación a la de 60 hembras por cada 40 machos. Este cambio se produjo en solo 10 generaciones debido a una variante genética que hacía que la toxina de Wolbachia no funcionase. Obviamente las mariposas sin Wolbachia se reprodujeron más y mejor reestableciendo el equilibrio entre sexos. Este fue un caso claro de evolución en acción en un espacio de tiempo reducido.

Wolbachia como barrera intraespecífica

El parasitismo de Wolbachia podría ser una explicación del porqué existen tantas especies distintas de insectos. Imaginemos que en vez de infectar invertebrados Wolbachia infectase personas. Imaginemos que una cepa de Wolbachia, llamémosla A, infecta a franceses, mientras que en España, una cepa B infecta españoles. Si el antídoto de la cepa A no funciona para la toxina de la cepa B y viceversa ¿Qué ocurriría? el resultado sería que los españoles no podríamos tener hijos con franceses ni los franceses con españoles. Esto convertiría técnicamente a españoles y franceses en especies distintas. Si eliminásemos las bacterias con un antibiótico entonces todo volvería a se como antes.

Esto mismo fue lo que hizo el investigador Jack Werren de la Universidad de Rochester con las avispas Nasonia. En la avispa Nasonia hay poblaciones que están colonizadas por una clase de Wolbachia que llamaremos cepa A, y otra población colonizada por la cepa B. Jack Werren observó que si intentaba aparear Nasonia portadora de la cepa A con Nasonia portadora de la cepa B, los embriones resultantes eran inviables. Esto es así por que el antídoto que produce la cepa A sólo corrige los defectos en el esperma de los machos colonizados con la cepa A, y lo mismo ocurre en las avispas colonizadas por la cepa B. Cuando Jack Werren trató las avispas con un antibiótico que eliminó las bacterias, entonces fue posible tener embriones viables cuando se apareaban las dos poblaciones de avispas colonizadas por cepas distintas de Wolbachia. Esto quiere decir que cuando la avispa Nasonia estaba colonizada con dos cepas distintas de Wolbachia cada población era una especie diferente ya que no podían cruzarse entre si. Pero si ambas poblaciones están libres de la bacteria, o las bacterias son eliminadas de la población de avispas con un antibiótico en este caso no hay barreras para el apareamiento entre ambas poblaciones.

Especies como matrioskas rusas

Las especies como matriuskas rusas: un saltamontes colonizado por una bacteria que vive dentro de sus células. Esta bacteria, a su vez contiene a su vez un virus. El virus le proporciona a la bacteria herramientas moleculares para que la bacteria se mantenga en la Especies como matrioskas rusaspoblación de saltamontes. De esta manera en un ejemplar de saltamontes infectado tendremos al saltamontes, la bacteria y el virus todo en uno. Pero aun hay más. Recientemente el grupo de McMeniman de la Universidad de Queensland ha conseguido infectar mosquitos transmisores del virus del Dengue con Wolbachia, otros grupos han descubierto que el gusano que causa la filariasis, una enfermedad tropical que afecta a 120 millones de personas, está a su vez infectado con la bacteria Wolbachia, y que si matan a la bacteria con un antibiótico, el gusano por si mismo no puede sobrevivir. De esta manera están administrando antibiótico a los enfermos de filariasis como tratamiento coadyuvante con éxito. Todo esto nos indica que a este sistema de tres bandas: virus, bacteria e invertebrado hay que añadir ahora un nivel más de complejidad, la tecnología que empleará la bacteria para mejorar la salud de otra especie, la nuestra.
Fig. 7. La ceguera de los ríos es la segunda causa de ceguera infecciosa en todo el mundo. Se transmite a los seres humanos por medio de la picadura de las moscas negras infectadas con el gusano parásito Onchocerca volvulus, que a su vez, tiene a la bacteria endosimbionte Wolbachia viviendo en sus genitales. 

Hasta ahora se pensaba que la enfermedad estaba causada por gusanos parásitos que construyen túneles en la piel y liberan millones de larvas que se distribuyen por todo el cuerpo hasta provocar una reacción inmune que conlleva la inflamación de los ojos y, posteriormente, ceguera. Parece ser que no son los parásitos los culpables sino la bacteria Wolbachia que vive en ellos. De hecho, es la responsable de la inflamación que acaba en ceguera y provoca además graves problemas en la piel. Si es una bacteria la responsable entonces podemos tratar esta enfermedad con antibióticos.

jueves, 12 de mayo de 2022

Detección de Legionella pneumophila por amplificación isoterma LAMP

En España es frecuente, sobre todo en verano, leer en la prensa que en determinada ciudad ha habido un brote de Legionella pneumophila. Suele causar alarma porque L. pneumophila es una bacteria que tiene una tasa de mortalidad elevada, entre 15-25% si afecta a pacientes inmunocomprometidos, fumadores, ancianos... El procedimiento es siempre el mismo: se busca por torres de refrigeración de centros comerciales, hospitales... El CDC nos informa que son en las torres de refrigeración, que emplean agua para enfriar el aire, en donde, por ausencia de limpieza puede crecer Legionella pneumophila. Los aires acondicionados caseros, o de los automóviles, no emplean agua para refrigerar por lo que no pueden ser fuentes de Legionella.


Para detectar Legionella se puede usar amplificación por LAMP, PCR o cultivo en medio selectivo. De los tres el más sensible es la amplificación isoterma LAMP.

También se puede detectar por real-time PCR.

Para identificar a Legionella pneumophila se emplea el gen mip (gene ID LPG_RS03920  Protein accesion Q5ZXE0.2). Este gen codifica para una proteína que potencia la infección de la bacteria en macrófagos.

>NC_002942.5:866850-867551 Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete sequence


ATGAAGATGAAATTGGTGACTGCAGCTGTTATGGGGCTTGCAATGTCAACAGCAATGGCTGCAACCGATGCCACATCATTAGCTACAGACAAGGATAAGTTGTCTTATAGCATTGGTGCCGATTTGGGGAAGAATTTTAAAAATCAAGGCATAGATGTTAATCCGGAAGCAATGGCTAAAGGCATGCAAGACGCTATGAGTGGCGCTCAATTGGCTTTAACCGAACAGCAAATGAAAGACGTTCTTAACAAGTTTCAGAAAGATTTGATGGCTAAGCGTACTGCTGAATTCAATAAGAAAGCGGATGAAAATAAAGTAAAAGGGGAAGCCTTTTTAACTGAAAACAAAAACAAGCCAGGCGTTGTTGTATTGCCAAGTGGTTTGCAATACAAAGTAATCAATTCTGGAAATGGTGTTAAACCCGGAAAATCGGATACAGTCACTGTCGAATATACTGGTCGTCTGATTGATGGTACCGTTTTTGACAGTACCGAAAAAACTGGTAAGCCAGCAACGTTCCAGGTTTCACAAGTTATCCCTGGATGGACAGAAGCTTTGCAATTGATGCCAGCTGGATCAACTTGGGAAATTTATGTTCCCTCAGGTCTTGCATATGGCCCACGTAGCGTTGGCGGACCTATTGGCCCAAATGAAACTTTAATATTTAAAATTCACTTAATTTCAGTGAAAAAATCATCTTAA

Página con programa para generar el complementario y el reverso del ADN https://www.bioinformatics.org/sms/rev_comp.html

Página con programa para diseñar los primers LAMP https://lamp.neb.com/

 

miércoles, 11 de mayo de 2022

La ciencia, al igual que los árboles, tiene sus raíces

Las personas somos un eslabón entre la generación que nos ha criado y la generación que nosotros criamos. Conviene recordarlo. Además de nuestros hijos, en el ámbito laboral nosotros nos formamos de nuestros maestros y formamos la generación que viene detrás. No solamente producimos ideas, publicamos artículos, defendemos nuestro trabajo... también somos responsables de la educación de aquellos que dependen de nosotros para formarse. 

La ciencia, al igual que los árboles, tiene sus raíces. En la fotografía árbol y hojas de la quina

Cuando comencé mi tesis doctoral, sobre cómo las fluoroquinolonas inhiben la actividad de las topoisomerasas, no tenía ni idea de quien había descubierto las propiedades curativas de la quina. La quina es un árbol del Ecuador. Sus propiedades curativas fueron descubiertas por el chamán Pedro Leiva. Posteriormente se aisló la molécula que posee el principio activo, la quinina. A esta molécula cuando se le añadió por síntesis orgánica un átomo de fluor se comprobó que tenía actividad antibiótica. Hoy en día las fluoroquinolonas son uno de los tres grupos de antibióticos más exitosos. ¿Qué une a un chamán ecuatoriano del siglo XVIII con un estudiante gallego de finales del siglo XX? Pues si, la molécula de la quina y sus propiedades antibióticas.

Molécula de la quinina que se extrae del árbol de la quina

El naturalista deviene en microbiólogo

Cuando era pequeño disfrutaba inmensamente de la naturaleza. Por eso me decidí por estudiarla. Al acabar mis estudios de grado me interesé en dos áreas de investigación, la genética de desarrollo y la microbiología. Me decidí por esta última por dos razones: el problema de salud pública que ya se intuía en el problema de las bacterias resistentes y el impacto tan rápido que tiene la selección natural en las poblaciones bacterianas. Gracias a una beca FPI de la Comunidad de Madrid pude realizar mi doctorado con la Dra Adela G. de la Campa en el Instituto de Salud Carlos III estudiando el mecanismo por el cual las fluoroquinolonas inhibían las topoisomerasas. Este trabajo me permitió aprender a secuenciar genes, caracterizarlos, clonarlos, expresarlos y realizar ensayos enzimáticos. Al acabar el doctorado me mudé a Ann Arbor, Michigan para trabajar en patogénesis microbiana. Fui becado por la MEC-Fullbright durante dos años. En el laboratorio de Michelle Swanson establecimos un modelo en el que Legionella pneumóphila inhibía la maduración del fagosoma liberando lipopolisacáridos de su membrana. Este trabajo recibió el Primer Premio Internacional Alcora de investigación en Legionelosis. 

Regresé a España con un contrato Isidro Parga de la Xunta de Galicia para trabajar en el INIBIC de A Coruña. En este periodo caractericé la actividad apoptótica y autofágica de una porina de Acinetobacter baumannii. Aquí realicé el trabajo del que estoy más satisfecho: comprobar por primera vez que las vesículas de membrana de A. baumannii podrían ser un vehículo para transformar horizontalmente otras especies como A. baylii. Durante este periodo, conseguí tres proyectos de divulgación científica y el entonces director del Museo Nacional de Ciencia y Tecnología me pidió colaborar para la construcción del museo en la ciudad. Posteriormente, en 2014 me mudé al Ecuador para trabajar como investigador Prometeo y comencé a trabajar como profesor e investigador en la Universidad de las Américas en Quito desde 2015-2021 en que me mudé a la Universidad Espíritu Santo de Guayaquil. En este periodo he estado trabajando en la perspectiva “Una sola salud” colaborando con la Universidad Central del Ecuador, testando la actividad biológica de compuestos de síntesis orgánica en colaboración con el Dr. Jaime Charris, de la Universidad Central de Venezuela, con el que logramos el Premio Nacional de Ciencia y Tecnología 2021 que concede el gobierno venezolano. Por último, estamos comenzando a publicar trabajos sobre pedagogía y enseñanza da la microbiología.

Las leyes de hierro

Lo mismo que Robert Michels acuñó la ley de hierro de las oligarquías para explicar cómo funcionan los partidos políticos en ciencia, como organización, no se escapa de esos mismos principios. Los que determinan el devenir del proceso científico son los gestores, los políticos, los empresarios... por un lado, y por otro lado el inveterado deseo de las personas que se dedican a la ciencia por pagar su hipoteca. La lucha por sobresalir en este mundo es cruenta: no hay cama para tanta gente. Una de las habilidades que no se explican en la academia es el poder entender qué quieren tus empleadores, que quieres tu, qué papel juegas, cómo hacer alianzas... de todo ello depende el éxito en la carrera científica. 

Sin embargo, la ciencia retiene todavía algo del espíritu artesano, de la idea medieval de que tu trabajo te reconcilia con algo superior a ti mismo. Cuando observamos que los procesos tienen una lógica, esa lógica nos sirve como punto de apoyo, como área de descanso en medio del desorden que se percibe alrededor nuestro. Esa lógica nos hace tener confianza en nuestras fuerzas y discernimiento. 

Bacterias que degradan hidrocarburos aisladas de la boca del depósito de gasolina

Si se estudian nichos ecológicos extraños como la boca del depósito de gasolina de los coches, un lugar seco, sin agua, nadie esperaría observar bacterias. Pues bien, allí se encuentran Pseudomonas, Stenotrophomonas, Staphylococcus y Bacillus, algunas de las cuales han mostrado un claro patrón de degradación del gasóleo. Se ha encontrado una nueva especie de Isoptericola que es capaz de degradar el diésel. Estas bacterias se pueden utilizar en biorremediación, es decir, para devolver a su condición natural un medio ambiente afectado por la contaminación. 

The car tank lid bacteriome: a reservoir of bacteria with potential in bioremediation of fuel. Àngela Vidal-Verdú, Daniela Gómez-Martínez, Adriel Latorre-Pérez, Juli Peretó, Manuel Porcar. npj Biofilms and Microbiomes.

domingo, 8 de mayo de 2022

Las algas tóxicas acabaron con la civilización Maya

Una plaga de algas nocivas infestó los acueductos mayas entre los siglos VIII y X, enfrentándolos a una crisis de agua potable hace 1,000 años. Además, los científicos reconocen que la debilitación de las ciudades mayas no se debieron únicamente a la infección de sus suministros de agua. Por el contrario, el proceso fue paulatino y es multifactorial, concluyen en el estudio.



sábado, 7 de mayo de 2022

¿Qué fue antes el huevo o la gallina?

Fig. 1. La evolución es el reflejo del paso del tiempo en ese código

Cuando era pequeño se oía este tipo de pregunta ¿Quién fue primero, el huevo o la gallina? las personas que te lo preguntaban ponían cara de ¡Oh, gran enigma!. Después de 25 años de estudio de la biología puedo asegurar que primero es el huevo (Y aprovecho para poner cara de ¡Después de 25 años de estudio de la biología! pena que no tenga una perilla para atusármela). De hecho seguimos siendo un huevo. Desde un punto de vista biológico sólo somos un huevo. Me explico. Cuando se fecunda un óvulo, éste empieza a dividirse. A las pocas divisiones ya se sabe que células van a ser las células sexuales, esto es, las únicas células del cuerpo humano que tendrán la oportunidad de pasar a la siguiente generación. Nuestros cuerpos son solo el contenedor de esas células que tendrán la oportunidad de pasar a la siguiente generación. Por supuesto esta es una visión reduccionista, pero desde un punto de vista biológico sólo importa aquellas células que se transmiten, esto es, el huevo. Fuimos huevo porque procedemos de un protozoo unicelular, y seguimos siendo un protozoo unicelular, un protozoo que pasa el 99.999999999999999999% de su tiempo con sus cromosomas repartidos entre dos células haploides: el óvulo y el espermatozoide.

El huevo fecundado comienza a dividirse. Cuando forma un puñado de células es cuando se dirime cuáles van a ser células sexuales y cuales somáticas. Las somáticas seremos nosotros, los humanos. Nuestra tarea será la de procurarle a nuestras células sexuales un background genético, es decir, si somos varones tenemos que buscarle un óvulo a nuestro espermatozoide, si somos mujeres un espermatozoide para nuestro óvulo. Los humanos, desde un punto de vista biológico solo somos portadores de nuestras células sexuales hasta que se genere un nuevo huevo del que se desarrollará un nuevo ser al que llamaremos hijo.

Preguntar que fue antes el huevo o la gallina es una pregunta trampa, porque no contempla la línea de tiempo que va implícita en nuestra información genética. En la figura 1 se observa como en la evolución, el huevo tal como lo conocemos aparece mucho antes de que en la Tierra aparezcan las aves. Los reptiles, de los cuales proceden las aves, ya ponían huevos. 

Cuando se estudia embriología, que es la ciencia que estudia el desarrollo de los embriones tiene un dicho: "la ontogenia recapitula la filogenia". Para los estudiantes de biología es una revelación. Al estudiar cómo se desarrolla un embrión se observa claramente como ese huevo se divide, forma un organismo pluricelular con una diferenciación de células sexuales y no sexuales (somáticas), se observa como forma un saco y como ese saco se pliega, vemos como el embrión es una especie de reptil con cola, como esa cola se reabsorbe, vemos unas agallas primitivas y membranas entre los dedos que van desapareciendo. Vemos la evolución del ser humano en el desarrollo del embrión. 

En biología, normalmente, lo más sencillo aparece en la evolución antes que lo complicado. Como diría el genetista T. Dobzhansky "Nada tiene sentido en biología si no es a la luz de la evolución". La evolución no es otra cosa que la influencia del paso del tiempo en ese material genético. Cuando se estudia biología se suele hacerlo desde una perspectiva antropocentrista. Estudiamos la célula humana y cuando comenzamos a estudiar las bacterias decimos: no tienen núcleo, no tienen organelos, no tienen... Como si lo normal fuese la célula humana y lo demás excepciones. 

Aquí tenemos que hablar de un concepto importante: 1 la evolución monofilética versus anastomosis. 

La primera célula fue una arqueobacteria. Cuando las cianobacterias llenaron la atmósfera de oxígeno, las arqueobacterias se retiraron de la superficie y se quedaron viviendo en lugares anóxicos, como fondo de mares, lagos, ríos, en el interior de la tierra... De las arqueobacterias aparecieron lo que nosotros llamamos bacterias verdaderas, más que nada porque como algunas causan enfermedades en humanos, son las que mejor conocemos. Bacterias como la del cólera, tuberculosis, disentería... A diferencia de las arqueobacterias, éstas son más pequeñas, no tienen citoesqueleto, son sacos a presión que evitan explotar gracias a una malla exterior de un material como de red que impiden que es presión interior las reviente.

La célula bacteriana es anterior en la evolución a la célula eucariota. 

Una arqueobacteria anaerobia fue parasitada por una eubacteria Gram negativa. Un estudio publicado por Martín Wu, plantea el siguiente escenario: las mitocondrias fueron bacterias Gram negativas que parasitaban el ATP de arqueobacterias. Con el tiempo, como veremos más adelante en este capítulo, fueron estrechando su relación con la arqueobacteriasy sólo se convirtieron en organismos simbióticos y por tanto beneficiosos cuando cambiaron de "chupar" el ATP a producirlo para el consorcio simbiótico. Por tanto, las células humanas proceden de una simbiosis entre bacterias. Es más, la célula eucariota surge por la simbiosis de varias bacterias, por ese motivo es más compleja. A esta teoría se le llama teoría endosimbiótica seriada, la cual explica que los hongos surgen de la simbiosis de esa bacterias Gram negativa y la arqueobacteria. Los animales habrían tenido otro evento simbiótico con una bacteria que les hubiese proporcionado la maquinaria molecular para la motilidad, y las plantas serían una célula con mitocondrias que además hubiese realizado una simbiosis con una cianobacteria con clorofila. De nuevo, de los más sencillo surge lo complicado.

Fig. 2. Cuando comenzó a aumentar la concentración de oxígeno en la atmósfera, las bacterias anaerobias, representadas de color azul comenzaron a desaparecer de la superficie de la Tierra. Fueron sustituídas por bacterias con capacidad de detoxificar el oxígeno atmosférico, en la imagen representadas por el color rojo. Hubo algunas bacterias anaerobias que fueron parasitadas por un tipo de bacterias Gram negativas. Con el tiempo, esta relación se hizo estable y se acabó formando una relación de mutua dependencia que derivó en la aparición de las células eucariotas.

En la célula eucariota, el tipo de célula de los humanos, también se puede hacer arqueología evolutiva. Por ejemplo, la glucolisis anaerobia tiene lugar en el citoplasma de la célula, mientras que el ciclo de Krebs y la fosforilación oxidativa tienen lugar en la mitocondria. La mayor parte de los genes de la bacteria aerobia de la que procede la mitocondria se perdió o se transfirieron al núcleo. El investigador gallego Antón Vila-Sanjurjo intentó, de forma muy valiente y arriesgada, dotar a la mitocondria de los genes necesarios para que llevase una vida independiente. La mitocondria está ya tan adaptada a la vida en el interior de la célula eucariota que fue incapaz de lograr su objetivo. Una nota curiosa para los frikis: Es interesante la ARN polimerasa de la mitocondria que no tiene que ver con las ARN polimerasa de bacterias ni de las células eucariotas, ambas compuestas de múltiples subunidades. La ARN polimerasa de la mitocondria es similar a la de los bacteriófagos.

La cooperación es "Quid pro quo" no paz y amor

El ser humano tiende a pensar de manera dual: Dios vs Satán, Sol y Luna, Caliente frío. Lo contrario de la competencia es la cooperación. Pensar esto último es un sesgo cultural. Ser competitivo no es ser un cabrón y ser cooperante es ser un hippie o un santo. En la cooperación existen unas reglas muy estrictas que cumplir. Estamos empezando a liberarnos de prejuicios y a entender las reglas del juego. Varios autores están mostrando que las relaciones entre las especies suelen ser competitivas. Para llegar a una simbiosis se dan varios pasos. Uno de los primeros es el parasitismo. Una vez que no puedes zafarte del parásito, comienza una aventura juntos, una aventura en la que ambas partes se vigilan para comprobar que la otra cumple la parte del trato. El último paso, como hemos visto en el caso de la mitocondria, consiste en centralizar toda la información genética en un núcleo común.

Vamos a ver varios casos para comprender este proceso. Una simbiosis actual son los líquenes, que son la asociación de un liquen con una cianobacteria. Si una piedra con un liquen la ponemos boca abajo de manera que no le de el sol, entonces el hongo se comerá a la cianobacteria porque al quedarse sin el alimento que le da la cianobacteria se la come. Si la piedra la metemos en un cubo con agua, el hongo se ahogará al no tener oxígeno y la cianobacteria no porque es capaz de producir O2 a partir de CO2 y H20. Son, al fin y al cabo organismos independientes. Por tanto, un líquen parece una especie vegetal cuando es un consorcio en el que una cianobacteria y un hongo están unidos y crean una estructura característica siempre y cuando se mantengan las condiciones y la relación entre ambos se respete.

Cuando una arqueobacteria se asoció con una bacteria Gram negativa, al principio eran una simbiosis. Finalmente, la mayoría de los genes, no todos, de la bacteria migraron y se fusionaron con el genoma de la arqueobacteria. La membrana plasmática de la arqueobacteria se invaginó y creó una membrana nuclear en donde se confinó. En ese momento se puede decir que aparece la primera célula con núcleo verdadero: la célula eucariota.

Endosimbiosis en marcha y por doquier

Prometheoarchaeum syntrophicum cepa MK-D1 es una arqueobacteria del grupo Asgard. Un grupo de científicos japoneses, después de 12 años de intentarlo, han conseguido aislarla de los sedimentos marinos y cultivarla en laboratorio, lo cual abre las puertas a la experimentación científica. ¿Por qué es tan interesante esta bacteria? porque crece mejor si está en asociación con otras bacterias. Además, forma tentáculos con los que puede atrapar a las bacterias que se volverán sus compañeras, formando así relaciones simbióticas con ellas.

Si tenemos un modelo bacteriano de simbiosis podremos empezar a hacerles preguntas. Es una pena porque ya han existido modelos semejantes, por ejemplo el de las amebas y la bacteria X del científico surcoreano Jeon. En este modelo se puede observar cómo las bacterias X y las amebas acaban formando una simbiosis perfecta, en donde las bacterias necesitan a la ameba pero la ameba no puede vivir sin ellas. En este blog ya le dediqué una entrada.

Gemmata obscuriglobus de las arqueobacterias a las eubacterias Gram negativas

Bacterias que nos enseñan que la teoría endosimbiótica de Lynn Margulis está en lo cierto existen algunas, como Gemmata obscuriglobus. Esta bacteria es una Gram negativa pero que carece de péptidoglicano. Una especie de eslabón perdido. Sería algo así como el paso de las arqueobacterias a las Gram negativas.

Esta bacteria es muy interesante porque al no tener peptidoglicano no tiene una presión interna elevada y su membrana crea compartimentos similares a los que tiene la célula eucariota. De hecho se cree que las invaginaciones de la membrana plasmática de esta bacteria serían como un preambulo del núcleo celular.

Célula endosimbionte en su proceso de convertirse en una organela celular

En el interior de la ameba de agua dulce Paulinella chromatophora vive lo que sería una célula endosimbionte en su proceso de convertirse en una organela celular. En el interior de Paulinella viven una o dos células endosimbiontes fotosintéticas que se asemejan a las cianobacterias. El genoma de este endosimbionte es considerable, 1 Mb (un millón de bases), lo que es pequeño para una cianobacteria de vida libre pero enorme para un cloroplasto. Este genoma no tiene nada que ver con los genomas de las β-cianobacterias que son las precursoras de los cloroplastos de las plantas. En realidad está emparentado con otro grupo de bacterias fotosintéticas: las Prochlorococcus/Synechococcus pertenecientes a las α-cianobacterias. Este dato es muy interesante porque subraya la idea de que los cloroplastos surgieron en la evolución en varios momentos de manera independiente.

Fig. 3. Paulinella chromatophora con cromatóforos. Photo Eva Nowack

Otro de las particularidades de este sistema endosimbiótico es que genes de este simbionte, genes que codifican proteínas del sistema fotosintético, se han transferido al núcleo de Paulinella. Este tipo de migraciones de genes de la organela al núcleo del hospedador es algo común en los organelas simbióticas como las mitocondrias o los cloroplastos pero no es frecuente observarlo en organismos simbiontes. Lo que tampoco es habitual es que el endosimbionte de Paulinella mantiene todos los componentes necesarios para que su cromosoma replique autonomamente.

El origen de replicación oriC is completamente idéntico a los de Prochlorococcus. Por lo tanto estamos delante de un organismo en el que se están dando los pasos para que un endosimbionte se convierta en una organela celular. Si entendemos como ocurre la transferencia de sus genes al núcleo y también cómo se sincroniza la replicación del cromosoma del simbionte con la de su hospedador podremos entender qué es lo que hace falta para que una célula simbionte se convierta en un orgánulo celular. Lo interesante del caso es que hasta ahora se suponía que algo semejante había ocurrido hace mucho mucho tiempo, cuando surgió las primeras células eucariotas y las células eucariotas que dieron lugar a las algas y a las plantas. Ahora, gracias a Paulinella, podemos tener a un evento evolutivo remoto desarrollarse ante nuestros ojos

La bacteria X crea un territorio en el cuerpo de la ameba

Kwang Jeon, investigador de la Universidad de Tennessee (EEUU) que trabajaba con amebas, observó un día por casualidad que uno de los lotes de amebas iba enfermando y muriendo. Pudo ver que estas amebas estaban infectadas por una bacteria que él llamó bacteria X, una bacteria que es prima de nuestra conocida Legionella pneumophila. Unas pocas bacterias lograron sobrevivir en esas amebas infectadas. Recordemos que las amebas son depredadores naturales de bacterias. La bacteria X, lo mismo que Legionella pneumophila, son capaces de resultar indigestas y evitar ser digeridas por la ameba. Las bacterias se reproducen en las amebas, las destruyen y salen nadando para buscar una nueva ameba.
Fig. 4. A La bacterias X nada hacia las amebas. Las amebas son depredadoras naturales de las bacterias, pero la bacteria X es "indigesta" para las amebas y cuando ya está dentro es capaz de reproducirse y matar a la ameba para salir de nuevo al medio acuático nadando hacia nuevas amebas. B Hay algunas amebas que pueden tener a las bacterias X sin que éstas las maten. C Kwang Jeon cultivó estas amebas que tenían en su interior a bacterias X que vivían en su interior. D Al cabo de cierto tiempo, si trataba a estas amebas con un antibiótico que mataba a la bacteria X las amebas se morían. Se demostró así que la simbiosis era posible reproducirla en el laboratorio y ver el proceso en tiempo real.

En 1966 el microbiólogo Kwang Jeon realizó un experimento con comunidades de amebas que proporcionaron pruebas de la teoría endosimbiótica. A La bacteria X, lo mismo que Legionella pneumophila, son bacterias que se reproducen en las amebas, las destruyen y nadan buscando otra ameba en la que puedan replicarse. Legionella se puede crecer en un medio de laboratorio, igual que la bacteria X, lo que nos indica que a priori son bacterias de vida libre. Por eso podemos infectar una comunidad de amebas (protozoos unicelulares) con la bacteria X que va a ser fagocitada por la ameba y ésta será incapaz de digerirla por lo que la bacteria X se replicará en su interior B La bacteria X provoca que la mayoría de las amebas enfermen y mueran. Muy pocas amebas sobrevivirán C Habrá algunas amebas que sobrevivan a la epidemia teniendo a la bacteria X en su interior. D Si a estas amebas con bacteria X en su interior se les administra antibióticos provocan que la ameba se muera. De esta manera, Jeon provó que las amebas después de muchas generaciones portando bacterias X en su interior se volvían dependientes de éstas para sobrevivir. Fuente

Durante diez años, Jeon cuidó de estas amebas que llegaron a reproducirse y a vivir de manera similar a las amebas que no estaban infectados con la bacteria X. Durante este tiempo Jeon se dió cuenta que las primeras amebas infectadas tenían alrededor de 100.000 bacterias en su interior, pero al cabo de diez años el número de bacterias que vivían en el interior de estas amebas disminuían hasta 40.000. Es decir, la bacteria X había autorregulado su número para que las amebas pudiesen tener un comportamiento “sano”. En ese punto de la coevolución de las dos especies la relación entre ambas era tan fuerte que si se trataba a las amebas con penicilina, que sólo mata bacterias, las amebas al verse privadas de sus bacterias morían. La simbiosis había sido tan fuerte que si uno de los miembros de esa relación íntima moría el otro se moría con él.

En esta relación simbiótica de suma distinta de cero existe una frontera que delimita esta relación: no puede haber una disolución de la relación alcanzada. En este juego de suma distinta de cero en donde Ameba y bacteria X tienen cierta ganancia, no existen dos participantes independientes, porque si muere uno también se muere el otro. Bacteria X ha perdido su capacidad de vivir libremente, la ameba ha perdido la capacidad de vivir sin la bacteria X en su interior. Existe por tanto algún mecanismo tipo toxina-antitoxina que hace que su unión sea indivisible. Ese mecanismo crea una frontera entre lo propio, es decir, la unión bacteria-ameba, y el mundo.

Un neurotransmisor para gobernarlos a todos: lecciones de Toxoplasma

Los adolescentes que tienen adicción a internet o a los smartphones experimentaron un aumento en los niveles en la corteza cingulada anterior de un neurotransmisor llamado ácido gamma aminobutírico (GABA), que inhibe o ralentiza las señales cerebrales,

Toxoplasma es capaz de alterar los niveles de dopamina y GABA de los humanos. Recientemente se ha visto que controla la mente de los cachorros de hiena y los vuelve más agresivos e imprudentes frente a los leones, lo que favorece que el parásito infecte a los leones después de que estos maten a estos cachorros y, concomitantemente, beneficie a las hienas que se benefician de estas crías kamikazes que las protegen del ataque de los leones.

En 2013, un artículo publicado en Nature, demostraba que el olor a orina de gato resultaba muy atractivo para aquellos ratones parasitados por Toxoplasma gondii.

Uno de cada tres estamos infectados por T. gondii

T. gondii infecta al 30-50% de la población mundial. El hospedador primario son los felinos. Es ahí en donde el parásito tiene su ciclo sexual. En los demás mamíferos vive de manera asexual y los "fuerza a ser comidos" por un felino. En el caso humano es bastante improbable que seamos devorados por un felino. Menos aún los delfines o las ballenas que también se contaminan con T. gondii debido a los ooquistes procedentes de las heces de los gatos y que llegan al mar por los deshechos urbanos.

Toxoplasma (y Plasmodium spp) tiene un apicoplasto y no puede vivir sin él

El apicoplasto es un orgánulo presente en la célula de la mayoría de los protistas llamados Apicomplexa como Plasmodium, que es el causante de la malaria, o Toxoplasma. En el caso de Toxoplasma cada protozoo contiene un único apicoplasto. Estos orgánulos son homólogos a los cloroplastos de los dinoflagelados, pero han perdido la clorofila y carecen de la capacidad de fotosintetizar. Estos protozoos no pueden vivir sin ellos, mantienen una relación simbiótica.  El apicoplasto está rodeado por cuatro membranas. Contiene su propio genoma: una molécula circular de ADN con un tamaño de 35.000 pares de bases que codifica aproximadamente 30 proteínas, un conjunto completo de ARNt y otras moléculas de ARN. Es capaz de reparar, replicar, transcribir y traducir sus genes. Puesto que 30 proteínas no son suficientes para la operación del apicoplasto, necesita importar otras proteínas (unas 500) del citplasma, codificadas por el genoma nuclear. Contiene partículas que se supone proceden de ribosomas de ascendencia bacteriana. 

Los protistas apicomplexa, como Toxoplasma y Plasmodium son simbiontes con los apicoplastos y este complejo simbiótico que tiene un estilo de vida endoparásito, es decir, necesita de células de otros organismos, como somos los mamíferos, para vivir. T. gondii es capaz de alterar los neurotransmisores del mamífero e incluso alterar el comportamiento de grupo de los mismos. La matriuska genética en todo su esplendor
 Lim, L. & McFadden, G. (2010). «The evolution, metabolism and functions of the apicoplast». Philosophical Transactions of the Royal Society 365: 749-763. PMC 2817234. PMID 20124342. doi:10.1098/rstb.2009.0273.