lunes, 18 de noviembre de 2019

Guerra bacteriana: Pseudomonas aeruginosa vs Staphylococcus aureus

Un nuevo estudio realizado por investigadores de la Universidad de Iowa sugiere que P. aeruginosa detecta moléculas secretadas por S. aureus y responde moviéndose rápidamente hacia S. aureus utilizando pequeños apéndices llamados pili para arrastrarse por la superficie. ✔Cuando los P. aeruginosa alcanzan las colonias de S. aureus , los invaden y los destruyen. Es importante destacar que los investigadores mostraron que P. aeruginosa es capaz de montar esta respuesta agresiva a una variedad de diferentes especies y cepas bacterianas recuperadas de una variedad de fuentes, incluidos los pacientes con fibrosis quística, lo que sugiere que esta puede ser una táctica universal utilizada por P. aeruginosa para competir contra otras especies bacterianas.
Las estrategias de aprovechamiento que las bacterias usan para competir entre sí pueden conducir a nuevas terapias antimicrobianas. Para saber más

viernes, 15 de noviembre de 2019

Un protozoo con capacidad para diseñar redes de comunicación

Un grupo de investigadores japoneses realizó un estudio con el protozoo Physarum polycephalum, un tipo de ameba, en donde se comprobó que construyeron una red de túbulos que conectaba fuentes de alimento de manera muy cercana a la red ferroviaria de Tokio. El experimento aprovechó la habilidad para producir túbulos que unen las colonias del moho con sus fuentes de alimento. Para ello, se utilizó una placa traslúcida que reproducía la posición central de Tokio y las ciudades satélite poniendo granos de avena simulando su distribución en el territorio. El resultado de la ameba (también llamado hongo mucilaginoso, aunque no pertenece al reino de los hongos) es muy similar a la red de ferrocarril de Tokio, una red que se ha construído a lo largo de muchos años y que el hongo es capaz de reproducir en pocas horas.

Referencias
Atsushi Tero, Seiji Takagi, Tetsu Saigusa, Kentaro Ito, Dan P. Bebber, Mark D. Fricker, Kenji Yumiki, Ryo Kobayashi, Toshiyuki Nakagaki. [www.sciencemag.org/cgi/content/abstract/327/5964/439 Rules for Biologically Inspired Adaptive Network Design]. Science, Vol. 327, No. 5964. (22 de enero de 2010), pp. 439-442.


martes, 12 de noviembre de 2019

Tutorial sobre epigenética

Tutorial sobre epigenética, para saber más pincha aquí

Genomic DNA is modified by chemical markers, which can change gene expression without altering the underlying genetic code. These so-called epigenetic tags (described in the videos) can also mark DNA to distinguish old strands from those that are freshly made, or can be used by the cell to identify foreign DNA. One of these epigenetic modifications is the addition of a methyl group to the DNA molecule; this methylation process is carried out by enzymes called methyltransferases. Different methyltransferase enzymes create different methyl tag patterns, and now scientists reporting in Nature Communications have learned more about linking methyltransferases to their methylation scheme.


If researchers attempt to introduce foreign DNA into an organism, such as when the genes required for manufacturing some important chemical are introduced into bacteria that are supposed to start making that chemical. Often, a host will reject this foreign DNA. The methylation patterns on the DNA molecule indicate that it's not native, and the host cell will destroy it. Bacteria that are commonly used in the lab, like E. coli, can usually withstand the introduction of foreign DNA and won't chop it up, but many other microbes will, impeding research.
Este video explica el proceso de metilación del ADN y su importancia en la transcripción eucariot usando metilasas de ADN y metilasas de histonas. Para más información: http://shomusbiology.weebly.com/ Para descargar material: http://shomusbiology.weebly.com/bio-m... Fuente: Dr. Anindita Banerjee, Department of Microbiology, St. Xavier's college

"Knowing which enzyme does what opens up to a lot of applications. With this knowledge, you can construct model organisms with artificial methylomes, mimicking the methylation pattern of the strain you want to introduce DNA to. In this way you can ensure [the] survival of introduced DNA," said the first author of the study, Specialist Torbjørn Ølshøj Jensen of The Novo Nordisk Foundation Center for Biosustainability (DTU Biosustain) at the Technical University of Denmark (TUM).

"Working in other bacteria than E. coli, you often have to do a lot of trial and error when it comes to DNA transformation, but that's just not good enough. You need knowledge and tools. With this, you have a systematic and rational way of fixing the problems," explained Jensen.

Working towards that goal, the researchers aimed to find what enzyme was creating which methylation pattern. They created circular strands of DNA (plasmids) that carried a methyltransferase gene. These were coupled with multiple copies of a specific DNA sequence, which were intended to be targets for the methyltransferase enzymes encoded by the plasmid. The team repeated this study for every methyltransferase.


The researchers could then observe the specific impact of individual methyltransferases by detecting the methyl groups on the target DNA sequences.

The scientists confirmed their results by assessing the genomes of two microbes used in manufacturing. Together, they carry 23 genes for methyltransferases, with twelve methylation patterns on their DNA. This suggested that not all their methyltrasnferases were at work, so the scientists looked for active methyltransferase genes in the bacterial genomes. After investigating the methylation patterns, they traced eleven of the twelve back to specific genes. This work can help create clearly defined 'methylomes' that describe methylation patterns in hosts, and make adding foreign DNA to these hosts easier
https://www.labroots.com/trending/genetics-and-genomics/15462/revealing-epigenetic-patterns-specific-enzymes-create?fbclid=IwAR3v3I-DwlyTDWX6rcx-C4Lxs-kcBjGVOGdvR8mwTVaIC6BkYCPmUxHQHU8

lunes, 11 de noviembre de 2019

¿Qué es la hipótesis del mundo ARN?

Me ha encantado esa comparación de que la célula en el fondo es la casa que protege y sostiene el mundo ARN.
Código genético y la relación clonal entre los distinto códones. Fuente
. Fuente

PREGUNTA: Tenemos un ORF:  ATGTATGGATACGCCTCTTCGGAGGGCAACTTAGAATAA
y a partir de esta secuencia tenemos una descendencia en la que se pueden observar tres mutantes:
Mutante 1:
ATGAATGGATACGCCTCTTCGGAGGGCAACTAGAATAA
Mutante 2:
ATGTACGGGTACGCATCGTCGGAGGGAAATTAGAATAA
Mutante 3:
ATGATATGGATACGCCTCTTCGGAGGGCAACTAGAATAA

¿Cuál de los mutantes tendrá más mutaciones? ¿Cuál de los mutantes será el que tenga menos? ¿Cómo afectarán esas mutaciones a la proteína resultante? Para ello traduce cada triplete utilizando la tabla 

SOLUCIÓN:
ORF: ATG TAT GGA TAC GCC TCT TCG GAG GGC AAC TAG AAT AA

1      ATG AAT GGA TAC GCC TCT TCG GAG GGC AAC TAG AAT AA

2      ATG TAC GGG TAC GCA TCG TCG GAG GGA AAT TAG AAT AA

3      ATG ATA TGG ATA CGC CTC TTC GGA GGG CAA CTA GAA TAA

PREGUNTA: Cuando no existían bacterias toda la vida sobre la Tierra era vírica. Eran protovirus de ARN que tenían ribosomas. Estos virus se replicaban en la sopa biológica (en Ecuador en el locro biológico). Cuando aparecieron las bacterias, éstas tenían una membrana que diferenciaba fuera de dentro. Las bacterias metieron dentro todo lo que les interesaba de la sopa biológica. Los protovirus al quedarse sin su alimento sufrieron una presión selectiva que favoreció a aquellos virus que sabían como penetrar en el interior de las bacterias y alimentarse de lo que antaño había sido suyo. Nacieron los virus como entidades parásitas de las células. Muchos biólogos siguen diciendo, de forma equivocada, que los virus no son entidades vivas porque se tienen que alimentar de una célula metabólicamente activa. Si es por eso, podríamos incluir en la categoría de virus a muchas personas que no son capaces de subsistir sin su tarjeta de crédito. ¿Cómo perdieron los protovirus sus ribosomas? porque hoy en día los virus actuales no tienen ribosomas. Como siempre la solución está en la selección natural. Imaginemos dos virus A y B. El virus A es un protovirus, tiene ribosomas, y su ARN tiene 60.000 bases. El virus B perdió los genes de los ribosomas y por esa razón tienen 40.000 bases. No necesita codificar ribosomas porque puede utilizar los de la bacteria que infecta. Ambos virus infectan y se replican en el interior de bacterias. Si la ARN polimerasa copia a una velocidad de 1000 bases por minuto y los cromosomas de A y B tienen un solo Ori. ¿Cuánto tiempo tarda cada virus en replicarse? ¿Cuánta descendencia tendrá cada virus al cabo de seis horas?

SOLUCIÓN: Virus A 30 minutos virus B 20 minutos. En seis horas tendremos de A  4096 virus, y de B tendremos 262144 virus. Si en vez de horas hablásemos de miles de años podemos entender porqué los virus actuales carecen de ribosomas.

PREGUNTA: ¿Qué fue antes el huevo o la gallina? ¿Qué proceso ocurrió antes en la evolución, el paso de ADN a ARN o el paso de ARN a proteínas? 

sábado, 9 de noviembre de 2019

Veintidós niños huérfanos coruñeses llevaron la vacuna por todo el mundo

El descubrimiento de la vacuna por Edward Jenner se publica en el año 1800. En 1803 sale de A Coruña una goleta con 22 niños huérfanos. A uno de esos niños se le ha inoculado el virus de la viruela de vaca, que protege a los humanos de la mortal viruela humana. Cuando a este niño le salen unas pequeñas pústulas, la única manifestación del virus de la vaca, los médicos pinchan la pústula y se la inoculan a otro niño. De esa manera, la Expedición Balmís, lleva el virus de la vaca, la vacuna, viva desde A Coruña a América. En Quito, la población se vacunó de manera masiva en 1805. Todavía no hay en la ciudad de Quito una calle, o un monumento que mencione esta gesta.
Fuente
Para saber más, pinchad aquí. Se trata de un artículo excelente de Laura Garofano publicado en el Mundo.



viernes, 8 de noviembre de 2019

Si soy capaz de transmitirme seré un parásito exitoso

El que vive a expensas de otros debe transmitirse una vez que ha agotado a su presa. La transmisión es una de las características de los patógenos. Pueden transmitirse por el agua, por el aire, o a través de animales hematófagos (se alimentan de sangre). Son los vectores, organismos vivos que pueden transmitir enfermedades infecciosas entre personas, o de animales a personas:

Las seis estructuras chupadoras de un mosquito buscando un capilar sanguíneo
Mosquitos. Los mosquitos han cambiado la historia de la humanidad, especialmente los géneros Aedes, Anopheles y Culex
Flebótomos, su picadura es el medio de transmisión de la leishmaniasis, de la bartonelosis y de algunas infecciones por arbovirus.
Las garrapatas transmiten encefalitis; enfermedad de Lyme; fiebre hemorrágica de Crimea-Congo; fiebre recurrente (borreliosis); ricketsiosis (fiebre maculosa y fiebre Q) y tularemia. Fuente
Triatominos: enfermedad de Chagas (tripanosomiasis americana). Fuente
Mosca tsetsé: enfermedad del sueño (tripanosomiasis africana). Fuente
Pulgas: peste (transmitidas por pulgas de las ratas al ser humano) y rickettsiosis. Fuente
Moscas negras: oncocercosis (ceguera de los ríos). Fuente
Caracoles acuáticos: esquistosomiasis (bilharziasis). Fuente
Piojos: tifus y fiebre recurrente transmitida por piojos. Fuente

miércoles, 6 de noviembre de 2019

¿Por qué los holandeses son tan altos?

PROBLEMA: Los holandeses en 1860 eran, como colectivo, de los más bajos de Europa. Ello era debido a que tenían una dieta pobre, basada en las papas y el maiz, y bebían agua contaminada. Holanda, como país, tiene gran parte de su territorio por debajo del nivel del mar. Gracias a unos diques, los polders, evitan que el mar inunde estas áreas. Por ese motivo, la capa freática se encuentra muy superficial. Como siempre ha tenido una cabaña ganadera muy importante, especialmente vacas, acordaros de sus famosos quesos, el agua en el siglo XIX se encontraba contaminada. Cuando variaron su dieta y empezaron a purificar el agua la altura de los holandeses pasó de 1.64 cm de media a 1.84 cm ¡Un aumento de 20 cm! SOLUCIÓN: una dieta variada y sobre todo, beber agua potable, hizo que aumentasen de tamaño



John Snow establece una relación epidemiológica entre el agua contaminada de heces y los brotes de cólera
En 1854 John Snow demuestra que el agua contaminada es el agente propagador de la cólera en Londres. En la fotografía, una de las bombas que se empleaban en el S XIX para proporcionar agua a la población
John Snow hizo un rastreo de las familias que presentaban casos de cólera y se dió cuenta que todas vivían alrededor de algunas bombas de agua. Curiosamente todas esas bombas pertenecían a la red de una empresa de suministro de aguas que tomaba el agua del Támesis, pero en vez de tomarla río arriba, tomaba el agua río abajo, cuando ya había sido contaminado con las heces de los habitantes de esta ciudad, muchos de ellos con cólera, con lo que se establecía un ciclo de contaminación fecal-oral.
John Snow, padre de la epidemiología moderna, cartografía los brotes de cólera y descubre que todos están asociados con bombas de agua contaminada con heces. En esa época no estaba claro el origen de las enfermedades infecciosas y muchos pensaban que las enfermedades las producían emanaciones de sitios pantanosos.
Fuente
En este gráfico se puede ver la evolución de las muertes causadas por agentes infecciosos por cada 100.000 habitantes en los USA durante el siglo XX. Alrededor de 1910 se implementó la cloración del agua en las ciudades de los EEUU. Se puede ver el impacto de esta medida en la drástica reducción de muertes por enfermedades infecciosas.

La higiene corta la transmisión fecal-oral

Eugenio Espejo, Ignacio Semmelweis, Joseph Lister... fueron pioneros en introducir la idea de que para parar las infecciones había que impedir la transmisión del agente causante de la infección. La vía de contaminación fecal-oral es la más habitual. Es decir, la que va desde las heces de personas o de mamíferos a la boca de otros seres humanos.
En el Ecuador se pueden observar filtros de piedra volcánica en casas y museos. El filtro funciona como un cedazo que impide que la bacteria o el parásito atraviese el filtro con lo que se interrumpe la vía de transmisión.

En Quito, la actual calle Guayaquil, se llamaba churretas, porque era una escorrentía de las churretas de porquería de la ciudad hacia la quebrada 24 de mayo. En tiempos de Eugenio Espejo, la ciudad de Quito, carecía de alcantarillado. De manera muy sagaz, el Dr. Espejo, intuyó que las personas contraían enfermedades de solo caminar por esas calles inmundas.
Filtro volcánico de piedra. Museo Casa del General Sucre en Quito
En Ecuador, se pueden observar filtros de piedra volcánica en la Casa del General Sucre en Quito. La existencia de estos filtros hablan de una comunidad preocupada por la limpieza y pureza del agua. Si tenemos en cuenta que el General Sucre compra su casa en 1828 y que en 1854 John Snow demuestra que el agua contaminada es el agente propagador de la cólera en Londres y que en 1860 es cuando Luis Pasteur establece la teoría microbiana de la enfermedad, estamos hablando de unas gentes que ya se preocupaban de la higiene.
Para saber más:
https://www.huffpost.com/entry/why-are-the-dutch-so-tall_b_5544085