martes, 28 de septiembre de 2021

Porphyromonas gingivalis, el Alzheimer y las gingipainas

El patógeno intracelular Porphyromonas gingivalis y la enfermedad de Alzheimer están relacionados. El grupo de Jan Potempa de la Universidad Kentucky en Louiville han detectado enzimas tóxicas llamadas gingipainas en el cerebro de pacientes con Alzheimer. Además, también encontraron esas gingipainas en cerebros de personas fallecidas que no fueron diagnosticadas con Alzheimer. Este punto es importantes por que el patógeno Porphyromonas gingivalis y el Alzheimer se habían relacionado, si, pero no se sabía si la enfermedad de las encías provoca Alzheimer o si es la demencia la que conduce a un cuidado bucal deficiente. Ahora, el hecho de encontrar gingipainas en personas que nunca fueron diagnosticadas de Alzheimer nos indica que esto es previo a la enfermedad, que se podría haber desarrollado si hubiesen vivido más tiempo.

Que tengas P gingivalis en la boca está asociada con el Alzheimer. (Foto: Wikimedia)

El Alzheimer no está relacionado con el virus del herpes

El grupo de Zhandong Liu del Baylor College Medicine publicaron en la revista Neuron, analizaron secuencias del virus a gran escala y el resultado es que no existe vínculo entre la abundancia de ADN o ARN viral del herpes y la probabilidad de padecer la enfermedad de Alzheimer en la cohorte de los tejidos cerebrales post-morten con Alzheimer que fue analizado en 2018. En este estudio se observó que los niveles del herpesvirus humano 6A (HHV-6A) y del herpesvirus humano 7 (HHV-7) en los tejidos cerebrales 'postmortem' de más de 1.000 pacientes con enfermedad de Alzheimer, comparados con los de cerebros de personas que no habían desarrollado la infermedad. Al reanalizar los datos vieron que no hay vínculo entre la abundancia de ADN o ARN viral del herpes y la probabilidad de padecer alzhéimer

lunes, 27 de septiembre de 2021

Reactor para formar biofilms desarrollado por el CDC

Desde la época de Koch, se ha investigado a las bacterias y microorganismos principalmente en su forma planctónica, es decir, en medio líquido. Sin embargo,  aunque se ha postulado que el 99% de las bacterias en un ecosistema existen como biopelículas, la investigación de microorganismos formadores de biopelículas puede considerarse un área nueva debido a la complejidad de estas muestras.

Un biofilm, o también llamado biopelícula, se define como un mosaico tridimensional en el que los microorganismos coexisten, se acumulan y se organizan en medio de una matriz de exopolisacáridos. Estas formaciones bacterianas son las principales causas de morbilidad y mortalidad en los pacientes, alcanzando aproximadamente el 5% al ​​15%. Es importante señalar que las infecciones bacterianas han sido el foco de atención de diferentes terapias; de hecho, el uso de antibióticos de manera racional y adecuada puede contribuir a la reducción de la morbilidad y mortalidad en los pacientes.

Por ese motivo, debemos de estudiar cómo afectan los antimicrobianos no solo en bacterias planctónicas, sino también en estas estructuras sésiles tridimensionales. Para ello, el reactor de cultivo continuo que se utiliza para estudiar biofilms es el que ha sido desarrollado por el CDC. Este reactor se ha convertido en el estandar para trabajar con biofilms en los laboratorios. 

Cada reactor tiene 8 racks y cada uno de ellos tiene espacio para tres fichas. Los biofilms crecerán, si  es que lo hacen, sobre esas fichas. El volumen del medio de cultivo líquido que cubre las fichas es de 350 mL. 

Se puede comprar en FisherSci por 1201.90$ producidos por  Biosurface Technologies Corp, que tienen su sede en Bozeman, Montana, EEUU. Esta empresa tiene fichas ("coupons" en inglés) de distintos materiales: teflón a 8$, polietilino 8$, polipropileno 8$, acero inoxidable 7.2$, hidroxiapatito 12$...)

Estas fichas se introducen en un vaso de un litro y se cubren con 350 mL de medio de cultivo continuo. La velocidad a la que este medio se introduce y elimina del vaso está regulada por una bomba peristáltica.

Las fichas con los biofilms se separan de los racks y se prueba sobre ellas distintas concentraciones de

fagos o de productos de síntesis según el esquema:



En la Universidad Estatal de Montana tienen un Centro de Engeniería de Biofilms, y tienen una serie de videos sobre como se comporta esta tecnología:
Single Tube Method Video. Fuente Biofilm First

Se necesita además:

Estufa de 37ºC
Una bomba peristáltica
Juego de tubos para la bomba peristáltica
Un baño de sonicación
 
Soporte universal con abrazadera

Tubos Falcon 50 ml


viernes, 24 de septiembre de 2021

El Experimento evolutivo más largo del Mundo

El experimento de Richard Lenski creciendo Escherichia coli día tras día ha sido un importante escuela para los microbiólogos interesados en evolución. Ahora el canal Veritasium nos lo presenta como documental en castellano: 

El Experimento evolutivo más largo del Mundo. Fuente: Veritasium en español

miércoles, 22 de septiembre de 2021

Lazareto de Guayaquil

 Una amiga el otro día, hablando sobre las cárceles del Ecuador dijo que lo mejor que se podría hacer con ellas era bombardearlas. El fin de semana después estuve en un cumpleaños en Quito y pregunté ¿Qué se podría hacer con las cárceles en Ecuador? y menos un profesor de derecho de la Universidad San Francisco y su pareja, el resto opinaban lo mismo que mi amiga. 

En ecuador en 1834,  el temor frente a la lepra sumado a la ausencia de conocimientos para enfrentarla hizo que unos ciudadanos solicitasen al presidente Vicente Rocafuerte que aquellos que padecían de lepra fueran inmolados para evitar el contagio. El presidente Rocafuerte rechazó evidentemente una medida tan inhumana y ordenó la construcción, en los terrenos donde funcionaba la Facultad de Medicina en la ciudad de Guayaquil, de un lazareto. Los contagiados de lepra en todo el mundo estuvieron bajo la advocación de San Lázaro y de la orden religiosa de igual nombre. Este lazareto, construido en madera fue quemado en 1945 en medio de gran expectación popular que disfrutó viendo como salían murciélagos y ratas de aquel edificio. 

El Lazareto de Boyacá se fundó en 1872 y se refundó en 1890 como ‘Alejo Lascano’. Guayaquil, 1900-1910.

En la decisión del presidente Rocafuerte influyeron decisivamente las opiniones de Abel Brandín, el cual abogaba por que quienes padecían lepra recibiesen un tratamiento “decente y humanitario”. 

Los lazaretos normalmente se diseñaban en islas cercanas a los puertos. Eran instalaciones en las que internaban a marineros y pasajeros, o animales que presentaban síntomas de enfermedades infecciosas.  La primera cuarentena fue practicada en el puerto de Marsella en 1383. 

Bandera amarilla, señal náutica que se usaba para señalar que se lleva enfermos infecciosos. Hoy en día indica lo contrario: un barco que se declara libre de enfermedad de cuarentena, y solicita el abordaje e inspección por parte de las autoridades portuarias. Fuente


lunes, 13 de septiembre de 2021

¿Qué podría hacer Guayaquil para combatir la sindemia del Sars-CoV-2?

 Covid-19 en Guayaquil: ¿Nos encontramos frente a una sindemia?


Muy interesante el concepto de sindemia. Abordar el COVID-19 significa abordar la hipertensión, la obesidad, la diabetes, las enfermedades cardiovasculares y respiratorias crónicas y el cáncer. Prestar mayor atención a las enfermedades no transmisibles (ENT) no es una agenda solo para las naciones más ricas. Las ENT también son una causa desatendida de mala salud en los países más pobres. La consecuencia más importante de ver a COVID-19 como una sindemia es subrayar sus orígenes sociales. La vulnerabilidad de los ciudadanos mayores; Comunidades étnicas negras, asiáticas y minoritarias; y los trabajadores clave a quienes comúnmente se les paga mal y con menos protecciones sociales apuntan a una verdad hasta ahora apenas reconocida, a saber, que no importa cuán efectivo sea un tratamiento o una vacuna protectora, la búsqueda de una solución puramente biomédica para COVID-19 fracasará. A menos que los gobiernos diseñen políticas y programas para revertir las profundas disparidades, nuestras sociedades nunca estarán verdaderamente seguras contra el COVID-19. Como escribieron Singer y sus colegas en 2017, "Un enfoque sindemico proporciona una orientación muy diferente a la medicina clínica y la salud pública al mostrar cómo un enfoque integrado para comprender y tratar enfermedades puede ser mucho más exitoso que simplemente controlar la enfermedad epidémica o tratar a pacientes individuales". Para saber más: Covid 19 no es una pandemia

¿Pueden las supermanzanas proteger al guasmo de una pandemia?

La pandemia afectó de manera distinta a Guayaquil que a Quito ¿Sería posible que cambiando el urbanismo cambiásemos los efectos del Covid-19 en la población?

¿Pueden las supermanzanas ser una solución para el sur de Guayaquil?

https://theconversation.com/el-caso-de-barcelona-demuestra-que-la-conquista-del-urbanismo-verde-no-es-facil-pero-sera-inevitable-166439

https://theconversation.com/la-historia-de-la-humanidad-es-una-sucesion-de-pandemias-pero-no-aprendemos-138172

Voces contrarias a las supermanzanas

¿Puede el concepto de ciudad de los 15 min ayudar al Guasmo?

https://theconversation.com/la-ciudad-de-los-15-minutos-el-comercio-de-barrio-y-la-libertad-de-los-consumidores-150224

Barrios frente a ciudadelas ¿Cuál es el mejor desarrollo?

Jane Jacobs defiende en su libro "Muerte y vida de las grandes ciudades" la abolición de los reglamentos de ordenación territorial y el restablecimiento de mercados libres de tierra, lo que daría como resultado barrios densos y de uso mixto 

https://www.sciencedirect.com/science/article/abs/pii/S014067361730003X

https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)32000-6/fulltext

https://www.bbc.com/mundo/noticias-54543375

¿Cambiar la dieta puede ayudarnos en esta pandemia?

Comprar en la veci ¿Es más efectivo frente al Covid-19 que comprar en grandes superficies?

https://www.avocesdecarabanchel.es/carabanchel/campana-compra-seguro-compra-tu-barrio-llega-pequeno-comercio

Terraceo y parras, una solución para comer en la calle

https://www.redaccionmedica.com/secciones/sanidad-hoy/covid-contagio-mascarilla-bar-restaurante-cerrado--5180

Alimentos, el riesgo oculto frente a la Covid-19

Mejorar el aire para luchar contra la pandemia

Referencia a Leonardo da Vinci https://www.bbc.com/mundo/noticias-48050229

Calidad de aire y coronavirus

https://theconversation.com/lo-que-sabemos-y-lo-que-no-sobre-la-relacion-entre-la-calidad-del-aire-y-el-coronavirus-138629

La bicicleta en tiempos del Covid-19

¿Qué es el R0 y como viajar en bici es mejor que en autobús urbano?

https://www.paho.org/es/noticias/18-5-2020-tiempos-covid-19-uso-bicicleta-es-imperativo-para-mantenernos-sanos-saludables

https://blogs.worldbank.org/es/voces/el-coronavirus-puede-dar-paso-a-ciudades-orientadas-a-peatones-y-ciclistas

miércoles, 8 de septiembre de 2021

Alineamiento de secuencias

 En esta época de pandemis aprender a alinear secuencias de ADN es una herramienta básica para saber de qué virus se trata el que está aquejando a nuestra comunidad y si está mutando, si la nueva mutación está cubierta por la inmunidad inducida por las vacunas que se han suministrado. Por eso vamos a aprender a distinguir las distintas secuencias, nucleotídicas o aminoacídicas, determinar si tienen un origen común...

Las secuencias biológicas pueden estar en nt o en aminoácidos

1 PREGUNTA: Encuentra un ORF (marco abierto de lectura) si lo hubiere, transcríbelo a mRNA y tradúcelo a su secuencia de aminoácidos

5’ ATGTTATTGTCGTATGCGACGTACATGTTTCATGCCCGT 3’

Solución: 



2 PREGUNTA: En esta secuencia existen dos ORFs mayores de 30 nt (normalmente por debajo de esta longitud no se consideran los posibles ORFs, es decir, no suelen llevar secuencias reguladoras, como la caja TATAA, RBS ect y por lo tanto no son ORFs que se transcriban). Uno en la secuencia que ves y el otro en su complementaria. Localízalos y tradúcelos a su secuencia de aminoácidos

5’CGCGGCATGATACGACGTCAGTCCACACGTCCACGTACACGACACCAATATCCGATACACTGATACCTAAAGGGGGACCGACAAAGACGACCGCCAGACGACCGGCGATACGAGCATAATACGATCTCTAGACGACCATACGACTAGACCTA 3’

Lo primero que vamos a hacer es separar de diez en diez los nucleótidos para poder contarlos con mayor facilidad

CGCGGCATGA TACGACGTCA GTCCACACGT CCACGTACAC GACACCAATA TCCGATACAC TGATACCTAA AGGGGGACCG ACAAAGACGA CCGCCAGACG ACCGGCGATA CGAGCATAAT ACGATCTCTA GACGACCATA CGACTAGACC TA
Vamos a encontrar un ORF en la secuencia 5’--> 3’

CGCGGCATGA TACGACGTCA GTCCACACGT CCACGTACAC GACACCAATA TCCGATACAC TGATACCTAA AGGGGGACCG ACAAAGACGA CCGCCAGACG ACCGGCGATA CGAGCATAAT ACGATCTCTA GACGACCATA CGACTAGACC TA

Esta secuencia en negrilla
ATG ATA CGA CGT CA G TCC ACA CGT CCA CGT ACA CGA CAC CAA TAT CCG ATA CAC TGA
Se traduce como: MIRRQSTRPRTRHQYPIH

Y otro ORF en la secuencia complementaria 3’-->5´. El truco para encontrar estas secuencias sin necesidad de hacer la secuencia complementaria es encontrar primero un CAT de derecha a izquierda y luego, buscando de tres en tres, encontrar un triplete CTA, TTA o un TCA, como se puede ver abajo resaltado en azul.

5’ CGCGGCATGA TACGACGTCA GTCCACACGT CCACGTACAC GACACCAATA TCCGATACAC TGATACCTAA AGGGGGACCG ACAAAGACGA CCGCCAGACG ACCGGCGATA CGAGCATAAT ACGATCTCTA GACGACCATA CGACTAGACC TA3’

Esta secuencia en azul si se escribiese como ADN codificante sería:
5’ATG CTC GTA TCG CCG GTC GTC TGG CGG TCG TCT TTG TCG GTC CCC CTT TAG 3’

Traducción: MLVSPVVWRSSLSVPL

3 PREGUNTA: Busca los ORFs en esta secuencia utilizando el programa https://www.ncbi.nlm.nih.gov/orffinder/ (Ojo los ORFs tienen que ser mayores de 30 nt)


5’CGCGGCATGATACGACGTCAGTCCACACGTCCACGTACACGACACCAATATCCGATACACTGATACCTAAAGGGGGACCGACAAAGACGACCGCCAGACGACCGGCGATACGAGCATAATACGATCTCTAGACGACCATACGACTAGACCTA 3’

ORF1: 5’ATGATACGACGTCAGTCCACACGTCCACGTACACGACACCAATATCCGAT
ACACTGA 3’

ORF2: 5'ATGCTCGTATCGCCGGTCGTCTGGCGGTCGTCTTTGTCGGTCCCCCTTTA
G 3'


4 PREGUNTA: Busca los ORFs en esta secuencia utilizando el programa https://www.ncbi.nlm.nih.gov/orffinder/ (Ojo los ORFs tienen que ser mayores de 30 nt). Poner en las opciones: Minimal ORF length (nt): 30

La secuencia
5’CGCGGCATGATACGACGTCAGTCCACACGTCCACGTACACGACACCAATATCCGATACACTGATACCTAAAGGGGGACCGACAAAGACGACCGCCAGACGACCGGCGATACGAGCATAATACGATCTCTAGACGACCATACGACTAGACCTA 3’

Se produce un cambio en la posición 51. Un cambio de T a G
Se produce un cambio en la posición 115. Un cambio de C a G
Y queda de la siguiente manera
5’CGCGGCATGATACGACGTCAGTCCACACGTCCACGTTGACGACACCAATATCCGATACACTGATACCTAAAGGGGGACCGACAAAGACGACCGCCAGACGACCGGCGATACGAGGATAATACGATCTCTAGACGACCATACGACTAGACCTA 3’

¿Cuántos ORFs existen?


El ORF1 anterior ahora es más corto por que el codon ACA se ha transformado en un codon de stop TGA
El ORF2 ha desaparecido al mutar el codon de inicio



5 PREGUNTA: Encuentra y traduce el ORF que se encuentra en esta secuencia (enlace tabla código genético):

5’ GGATGCTTAGCGTACGAGCGCCGACGCACCCGACCACATTTTATCTTACGGG 3’

Solución: Pincha aquí

5’ GGATGCTTAGCGTACGAGCGCCGACGCACCCGACCACATTTTATCTTACGGG 3’
El ORF empieza en el nt39 y acaba en el 7
ATGTGGTCGGGTGCGTCGGCGCTCGTACGCTAA
MWSGASALVR

6 PREGUNTA: Encuentra el ORF, tradúcelo y di cuáles son las propiedades químicas de sus aminoácidos
5’ TTATTGTCGTATGCGACGTACATGTTTCAT 3’
Solución:


7 PREGUNTA: en la secuencia que se encuentra en la pregunta anterior se observan dos aminoácidos que están codificados por dos codones distintos ¿Por qué ocurre esto?
Solución: Pincha aquí

¿Por qué una secuencia genética comienza a generar distintas secuencias?

8 PREGUNTA: ¿Por qué aparece en la 3 generación una secuencia diferente? ¿Por adaptación?



No todas las diferencias en secuencias tienen la misma importancia


9 PREGUNTA: Supongamos que la secuencia A es la secuencia ancestral de donde parten B, C, D y E. a) Ordena estas secuencias de mayor a menor diferencias genéticas b) Ordénalas ahora de mayor a menor diferencias aminoacídicas. Enlace al código genético. Programa para traducir DNA en proteínas

A 5´ATGCAAGCTTGGCGTAATCATGACTACTAA 3´

B 5´ATGCAGGCTTGGCGTAATCATGACTACTAA 3

C 5´ATGCATGCGTGACGTAATCATGACTACTAA 3

D 5´ATGCAAGCTTGGCGCTAATCATGACTACTAA 3

E 5´ATGCATGTGTTACATAACCACGATTACTAA 3

Solución: 

A             MQAWRNHDY

B             MQAWRNHDY Similitud 9/9 100%

C             MHA-RNHDY Similitud 2/9

D             MQAWR-S-LL Similitud 4/9

E              MHVLHNHDY- Similitud 5/9

 A 5´ATG CAA GCT TGG CGT AAT CAT GAC TAC TAA

B 5´ATG CAG GCT TGG CGT AAT CAT GAC TAC TAA 3

C 5´ATG CAT GCG TGA CGT AAT CAT GAC TAC TAA 3´

D 5´ATG CAA GCT TGG CGC TAA TCA TGA CTA CTA A 3´

E 5´ATG CAT GTG TTA CAT AAC CAC GAT TAC TAA

En ambos casos, nt y aminoácidos, la B es la secuencia más similar, seguida de la E, la D y por último la C 

¿Cómo se puede ordenar las secuencias para ver si tienen un antepasado común?

Árbol genealógico de los Restrepo

Árbol genealógico de Leonardo Da Vinci

10 PREGUNTA: ¿Cómo puedo rastrear mi linaje materno? ¿Y el paterno?


11 PREGUNTA: ¿De qué depende que en 2020 haya una frecuencia de clones determinada y en 2021 haya otra frecuencia?

Blast una herramienta bioinformática para alinear secuencias según similitud

Tutorial BLAST en español

Ejecutar y analizar los resultados de un Blast (Parte 1 de 2)

Ejecutar y analizar los resultados de un Blast (Parte 2 de 2)

12 PREGUNTA: Con el genoma del plásmido pUC19 encuentra el gen de la betalactamasa, el que le da resistencia a la ampicilina, y haz un blast con su secuencia. ¿Existe ese gen en otros plásmidos, bacterias? 

lunes, 6 de septiembre de 2021

David Baltimore, introducción a los virus

 Qué mejor manera que introducirnos en el mundo de los virus que de la mano del premio Nobel David Baltimore. En 20 minutos nos cuenta de manera resumida qué son los virus. Lo único que se echa en falta es que nos cuente cómo se forma un supervirus. Por lo demás, cuando habla el maestro los demás escuchamos. 

David Baltimore (Caltech): Introduction to Viruses 0:50 Un reino separado; 1:15 persiguiendo la sopa biológica; 1:35 RNA o DNA como soporte de información genética; 2:00 Remanentes de un mundo RNA; 2:31 El dogma actualizado; 3:15 Clasificación Baltimore 6:15 Tipos de virus; 7:16 Crecimiento de los virus; 7:58 Detrás de cada virus hay una historia de transmisión; 10:40 Placas de lisis; 11:50 Virus en equilibrio con el hospedador; 16:20 HIV; 17:30 Descubrimiento de la retrotranscriptasa

0:50 Un reino separado

La evolución empezó con el primer ser vivo, el ribozima. A partir de ahí ha habido la evolución ha sufrido varios saltos para llegar desde esa molécula sencilla de ARN con actividad enzimática hasta los seres pluricelulares complejos y sociales.

Las ribozimas, junto con los viroides (o protovirus), son considerados reliquias vivas del mundo de ARN y caracterizaron la primera fase del mundo de ARN. Posteriormente las ribozimas y viroides darían lugar a moléculas de ARN capaces de sintetizar proteínas como los ribosomas, a los retroelementos como la transcriptasa inversa y a las moléculas de ADN. Estas moléculas al rodearse con liposomas formados espontáneamente originarían los protobiontes y estos por último a las células modernas.

PREGUNTA 1. i) Tengo dos ribozimas: A y B. El ribozima A tiene un cromosoma con 10.000 genes y se divide en dos ribozimas cada 40 minutos. El ribozima B tiene 5000 genes. ¿Cuánto tiempo tarda B en dividirse?. ii) ¿Cuántas ribozimas dejará de descendencia el ribozima A y cuántas el ribozima B tras 4 horas de crecimiento?

Solución: El ribozima tarda la mitad de tiempo, 20 min. 4 horas son 240 minutos. Dividimos 240 entre 40 min y obtenemos el número de divisiones que tiene el virus A en 4 horas: 6 divisiones o también se puede decir 6 generaciones.

1 -> 2 -> 4 ->8 -> 16 -> 32 -> 64 en decir en 6 generaciones pasa d 1 a 64 individuos. También se puede expresar como:

20 -> 21 -> 22 -> 23 -> 24 -> 25 ->26

2n = número de descendientes después de n generaciones. Por lo tanto, la solución es 26 = 64

El ribozima B tiene 12 generaciones. 212 = 4096 descendientes. 

El organismo que tiene un tiempo de generación más corto deja más descendientes. Lo mismo ocurre en la película IDIOCRACIA

El árbol de la vida se expande de esta manera. Ya no consideramos que los únicos seres vivos son los que están basado en células. Los ribozimas y los virus son también organismos vivos porque siguen los mismos principios que dirigen la evolución. Por eso mismo, podemos empezar a soñar en un momento en que exista una rama de la vida que no sea biota, es decir, basada en la química del carbono. Una vida basada en el silicio y el código digital. 

1:15 Persiguiendo la sopa biológica

Recientemente han aparecido unos virus muy grandes, los tupanvirus, que tienen algunos genes de ribosomas. Existen dos teorías sobre el origen de los virus. La primera dice que en un principio los virus funcionaban como una célula primitiva y que evolucionaron a organismos parásitos y la otra que sugiere que los virus son DNA egoísta que evolucionó para parecerse a pequeñas células.

Estos tupan virus sugieren que los protovirus (virus con ribosomas) eran entidades biológicas simples que vivían replicándose en la sopa biológica y que cuando aparecieron las primeras células procariotas y estas células con membrana lipídica agotaron la sopa biológica con sus rutas metabólicas más complejas y su capacidad de almacenamiento, evolucionaron para convertirse en parásitos de esas nuevas entidades biológicas más grandes y con más capacidad para generar energía.


PREGUNTA 2: Cuando no existían bacterias toda la vida sobre la Tierra era vírica. Eran protovirus de ARN que tenían ribosomas. Estos virus se replicaban en la sopa biológica (en Ecuador en el locro biológico). Cuando aparecieron las bacterias, éstas tenían una membrana que diferenciaba fuera de dentro. Las bacterias metieron dentro todo lo que les interesaba de la sopa biológica. Los protovirus al quedarse sin su alimento sufrieron una presión selectiva que favoreció a aquellos virus que sabían como penetrar en el interior de las bacterias y alimentarse de lo que antaño había sido suyo. Nacieron los virus como entidades parásitas de las células. Muchos biólogos siguen diciendo, de forma equivocada, que los virus no son entidades vivas porque se tienen que alimentar de una célula metabólicamente activa. Si es por eso, podríamos incluir en la categoría de virus a muchas personas que no son capaces de subsistir sin su tarjeta de crédito. ¿Cómo perdieron los protovirus sus ribosomas? porque hoy en día los virus actuales no tienen ribosomas. Como siempre la solución está en la selección natural. Imaginemos dos virus A y B. El virus A es un protovirus, tiene ribosomas, y su ARN tiene 60.000 bases. El virus B perdió los genes de los ribosomas y por esa razón tienen 40.000 bases. No necesita codificar ribosomas porque puede utilizar los de la bacteria que infecta. Ambos virus infectan y se replican en el interior de bacterias. Si la ARN polimerasa copia a una velocidad de 1000 bases por minuto y los cromosomas de A y B tienen un solo Ori. ¿Cuánto tiempo tarda cada virus en replicarse? ¿Cuánta descendencia tendrá cada virus al cabo de seis horas?

SOLUCIÓN: Virus A 30 minutos virus B 20 minutos. En seis horas tendremos de A  4096 virus, y de B tendremos 262144 virus. Si en vez de horas hablásemos de miles de años podemos entender porqué los virus actuales carecen de ribosomas.

1:35 RNA o DNA como soporte de información genética

PREGUNTA 3: ¿Qué fue antes el huevo o la gallina? ¿Qué proceso ocurrió antes en la evolución, el paso de ADN a ARN o el paso de ARN a proteínas?

Solución: pincha aquí

PREGUNTA 4: Cuando entra un virus en una célula ¿Qué ribosoma utilizará para traducir su ARNm, un ribosoma viral o un ribosoma de la célula humana? ¿Por qué?

Solución: Los virus no tienen ribosomas propios, utilizan siempre el ribosoma de la célula hospedadora. Los virus perdieron los ribosomas propios cuando aparecieron las primeras células porque aquellos virus que carecían de ellos se replicaban mucho más rápido, al tener menos genes, que los protovirus que si los poseían.

2:00 Remanentes de un mundo RNA

¿Qué es la hipótesis del mundo de ARN?

2:31 El dogma actualizado

Gracias a esta actualización podemos entender el concepto de hebra positiva (la que tiene el mismo código que el ARNm) y la negativa. Es decir, la hebra positiva es el ADN codificante y la hebra negativa el ADN molde. Lo que copiará la RNApolimerasa será la hebra de ADN molde.

PREGUNTA 5: En esta cadena de ADN descubre el ORF

Solución: 

PREGUNTA 6: Dada la secuencia de ADN bicatenario :

3´ - T G C C G T T A C C T A T C T G TG C G A G A G C G A T C A A T C T G C 5´

5´ - A C G G C A AT G G A T A G A C A C G C T C T C G C T A G T T A G A C G 3´

Indicar la secuencia de bases del correspondiente ARNm. ¿Qué hebra del ADN es la codificante y cuál es la correspondiente al ADN molde?

PREGUNTA 7: ¿Por qué utilizamos la tabla ADN/Aminoácidos y no la tabla ARN/Aminoácidos en genética?

Solución: pincha aquí 

PREGUNTA 8: Tenemos el ADN molde:

3´TACCCAGATGTCACTTTTCATCAAACCATT 5´

¿Qué ARNm transcribirá? 
Solución: pincha aquí hasta el min 0:18

3:15 Clasificación Baltimore


PREGUNTA 9: ¿A qué grupo de la clasificación de Baltimore pertenece el Sars-CoV-2? para ver el ciclo vital del Sars-CoV-2 pincha aquí.

Solución: grupo IV

jueves, 2 de septiembre de 2021

Práctica encuentra los ORFs en las secuencias de ADN

Cuando empezamos a aprender a leer tenemos que aprender a reconocer una frase. Nosotros usamos el alfabeto latino (ABCDEFGHIJKLMNÑOPQRSTUVWYZ). El alfabeto latino procede de otros alfabetos anteriores en el tiempo. Como la escritura apareció en muchos sitios distintos existen otros alfabetos como el griego, el árabe, el armenio, el georgiano, el coreano. Las frases en castellano, y en los idiomas que usan el alfabeto latino  empiezan por Una letra mayúscula y acaban en un punto. Como por ejemplo: 

En el caso del código genético existe uno solo para todos los organismos vivos. Esto es así porque todos los organismos vivos proceden de un mismo antepasado común al que los biólogos le hemos puesto nombre: Luka. Como todos procedemos de un mismo progenitor nuestro código se basa en 4 letras A G C T. En los ordenadores y en los robots, su código de información se basa en 0 y 1. Cada 0 (el apagado del procesador) o el 1 (el encendido) se llama bit, y cada 8 bits tenemos 1 byte. Cuando escribimos un whasap cada letra de alfabeto latino viene codificada en bytes. Es lo que se llama el código ASCII

En el caso genético, lo mismo que el código informático, las 4 letras A G C T, lo que serían el 0 y 1 en el código informático, se toman de tres en tres (lo que llamamos tripletes) y no de ocho en ocho como en los computadores. La mayúscula el comienzo de la frase es el triplete ATG y el punto puede ser cualquiera de estos tres tripletes: TAA, TGA, TAG.

Un ORF sería, por ejemplo, la siguiente secuencia de ejemplo: 

5´ATG CCC GCT ATC TAA 3´
5´ATG CCC GCT ATC TGA 3´
5´ATG CCC GCT ATC TAG 3´

En el primer gen que secuencié, podemos ver también un ATG y un stop TAA:

Vamos a practicar a encontrar ORF:

1 PREGUNTA: Encuentra el ORF en este fragmento de ADN. ATG comienzo y stop TAA; TAG o TGA. Tamaño del ORF en nt (el stop cuenta)

5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'

Solución: Una secuencia genética se escribe usualmente utilizando una de las dos hebras de ADN. La razón, ahorrar espacio, como la información de la otra hebra se extrae automáticamente porque es complementaria por ese motivo no se suele representar. Para hacer un ejercicio de PCR necesitamos escribirla.

5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'

3' TGGATCGGAAAGGTTTACGCGTAATGTTATATATT 5' 

Ahora tenemos que buscar un ORF (Open reading frame en inglés) el ORF es la información del gen que se va a traducir a proteína. El ORF consta de un ATG, que es el inicio, lo mismo que en castellano sería la primera letra, siempre en mayúscula, de una frase, y un stop, que sería el punto al final de la frase si en vez de código genético estuviésemos trabajando con frases en castellano.

5' ACCTAGCCTTTCCAAATG/CGC/ATT/ACA/ATA/TAT/AA 3'

Primero situamos el ATG y de 5' a 3' empezamos a buscar triplete a triplete un stop. ¿No hay stop? entonces no hay un ORF en la hebra de arriba. Vamos a buscarla en la de abajo.

En la hebra de abajo tenemos que leer de 5' a 3' también, pero OJO hay que leer como los árabes, de derecha a izquierda

3' TGGAT/CGG/AAA/GGT/TTA/CGC/GTAATGTTATATATT 5'

En la hebra de abajo tenemos un ORF. Se trata de un ORF (tamaño escolar, en la realidad los genes suelen ser mucho más grandes) de 21 nucleótidos que codifica para una proteína de 6 aminoácidos.

Ahora vamos a amplificar este ORF mediante PCR. Tenemos que diseñar unos primers. Normalmente los primers tienen una longitud de entre 15 y 20 nucleótidos. Nosotros para este ejercicio vamos a utilizar unos primers de 5 nucleótidos.

Si eliminamos la parte del ADN que no nos interesa para que nos sea más fácil trabajar
 
5'  CTA GCCTTTCC AAATGCGCAT 3'
3'  GATCGGAAAGGTTTACGCGTA 5'

El ORF se encuentra en la hebra de abajo, la que va 3´-> 5´. Si esta hebra le "damos la vuelta" para que podamos verla de 5´->3´quedaría así: 5´ ATG CGC ATT TGG AAA GGC TAG 3´

2 PREGUNTA:

Identifica el ORF en esta secuencia de ADN y di cuantos nt tiene:

5' TATGTTTTATAAAGTCGGATATCTAACCCTTGTCACGTATTTCATGCGCGATGG 3'

Respuesta: ver el video hasta el min 2:44

3 PREGUNTA: Identifica el ORF en esta secuencia de ADN.  ¿Cuántos nucleótidos tiene este ORF?

5'TATGTTTTTTAAAGTCGGATATCTAACCCTTGTCACGTATTTCATGCGCTAGGG 3'

Respuesta: el ORF tiene 51 nucleótidos  5'ATGTTTTTTAAAGTCGGATATCTAACCCTTGTCACGTATTTCATGCGCTAG 3´

4 PREGUNTA:

5' TATGTTTTATAAAGTCGGATATCTAACCCTTGTCACGTATTTCATGCGCGATGG 3'

Identifica el ORF en esta secuencia de ADN ¿Cuántos nucleótidos tiene este ORF?

Respuesta: no encontramos el ORF en la secuencia 5´->3´. Encontramos el ORF en la secuencia 3´-> 5´: ATG AAA TAC GTG ACA AGG GTT AGA TAT CCG ACT TTA TAA  

--------------------------------------------------------------------------------------------------------------------------

Por supuesto tenemos herramientas informáticas para hacer este proceso automático. La página del "National Center for Biotechnology Information", también conocido por "NCBI", de los Servicios Nacionales de Salud de los EEUU "NIH" proporciona todas estas herramientas. En el buscador ponemos Genbank para entrar en el banco de genes del NCBI. Ya en el Genbank escribimos Cloning vector pUC19, complete sequence.

El plásmido pUC19 tiene su secuencia en esta página en formato FASTA

Si copiamos la secuencia Fasta de pUC19 y la introducimos en el program ORF Finder del NCBI, y en las especificaciones escogemos que aparezcan los ORF mayores de 75 nt. 

Obtenemos estos ORF. Vemos en el gráfico que el pUC19 tiene dos genes, el de la resistencia al antibiótico ampicilina y el gen lacZ que va a colorear a las colonias de Escherichia coli portadoras de este plásmido

En el gráfico de los ORF de pUC19 vemos que aparecen muchos más ORFs, en concreto 16 ORF. Lo que el algoritmo busca son ATG y en pauta de lectura, es decir, de tres en tres, un stop (TAA, TAG o TGA). Para que un ORF se convierta en proteína se necesitan algunas cosas más, pero de eso no hablaremos en este post. En realidad solo dos de estos 16 ORFs que ha detectado el ORF finders son ORF que corresponden a los genes Ampicilina resistance (ApR) y la beta-galactosidasa LacZ

5 PREGUNTA: Localiza el gen Ampicilina resistance entre los  16 ORF que ha detectado el ORF finder.

Solución: posiblemente el ORF más grande, el ORF6 sea el correspondiente al gen ApR

Para comprobarlo debemos de hacer un Blast. En la propia página del ORF finder, en la esquina inferior izquierda tenemos un botón para que, si tenemos seleccionado el ORF6 seleccionado, entrar en el Blast. El resultado nos muestra que todas las secuencias similares que ha encontrado el Blast son de un gen de proteínas betalactamasas, es decir, proteínas que confieren resistencia a la ampicilina. Por lo tanto, el ORF6 es realmente el gene Ampicilina resistance (ApR)

6 PREGUNTA: ¿Es un gen el ORF11?

7 PREGUNTA: ¿Es un gen el ORF5?

8 PREGUNTA: En el gráfico:

¿Por qué algunos ORF tienen flechas hacia un lado y otros ORF para el otro lado? ¿Por qué en el caso del ORF5 el estar está en la posición 216 y el stop en 539?