lunes, 30 de agosto de 2021

pUC19, un plásmido para todo

pUC19 es uno de una serie de vectores de clonación de plásmidos creados por Joachim Messing y colaboradores. [1] La designación "pUC" se deriva del prefijo "p" clásico (que denota "plásmido") y la abreviatura de la Universidad de California, donde se habían realizado los primeros trabajos sobre la serie de plásmidos. Es un ADN circular de doble hebra y tiene 2686 pares de bases. pUC19 es una de las moléculas de vector más ampliamente utilizadas, ya que los recombinantes, o las células en las que se ha introducido ADN extraño, pueden distinguirse fácilmente de los no recombinantes basándose en las diferencias de color de las colonias en los medios de crecimiento. pUC18 es similar a pUC19, pero la región MCS está invertida.

En particular, tiene un fragmento N-terminal del gen de la β-galactosidasa (lacZ) de E. coli. La región del sitio de clonación múltiple (MCS) se divide en los codones 6-7 del gen lacZ, lo que proporciona muchos sitios de restricción de endonucleasas de restricción. [5] Además de la β-galactosidasa, pUC19 también codifica un gen de resistencia a la ampicilina (ampR), a través de una enzima β-lactamasa que funciona degradando la ampicilina y reduciendo su toxicidad para el huésped. 

El sitio ori, o el origen de la replicación, se deriva del plásmido pMB1. pUC19 es pequeño pero tiene un alto número de copias. El alto número de copias es el resultado de la falta del gen rop y una mutación puntual única en el ori de pMB1. El gen lacZ codifica la β-galactosidasa. Los sitios de reconocimiento para las enzimas de restricción HindIII, SphI, PstI, SalI, XbaI, BamHI, SmaI, KpnI, SacI y EcoRI se han derivado del vector M13mp19. 

El fragmento lac Z, cuya síntesis puede ser inducida por IPTG, es capaz de complementación intraalélica con una forma defectuosa de la enzima β-galactosidasa codificada por el cromosoma del huésped (mutación lacZDM15 en las cepas de E. coli JM109, DH5α y XL1-Blue). En presencia de IPTG en el medio de crecimiento, las bacterias sintetizan ambos fragmentos de la enzima. Ambos fragmentos pueden hidrolizar juntos X-gal (5-bromo-4-cloro-3-indolil-beta-D-galactopiranósido) y formar colonias azules cuando se cultivan en medios donde se complementa.

La inserción de ADN extraño en el MCS ubicado dentro del gen lac Z provoca la inactivación por inserción de este gen en el fragmento N-terminal de la beta-galactosidasa y anula la complementación intraalélica. Por lo tanto, las bacterias que llevan plásmidos recombinantes en el MCS no pueden hidrolizar X-gal, dando lugar a colonias blancas, que se pueden distinguir en los medios de cultivo de las células no recombinantes, que son azules. 

Por lo tanto, los medios utilizados deben contener ampicilina, IPTG y X-gal.

La secuencia en formato fasta

>pUC19 [length=2686] [version=09-MAY-2008] [topology=circular] Cloning vector pUC19, complete sequence.

TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC

Entremos en el ORF finder. Si buscamos ORF mayores de 75 nt entonces vemos que el ORF14 es el más grande. Si hacemos un blast p observamos que se trata de una betalactamasa, un gen que nos va a dar resistencia frente al antibiótico ampicilina.

La secuencia de la betalactamasa está en la hebra 3´-> 5´

5´ ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAA 3´

Para conversión de secuencia a reversa, complementaria y reversa complementaria utilizamos el programa que está en el hipervínculo. En esta dirección hay otras herramientas interesantes

5´ TTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT 3´

De esa manera, podemos localizar el gen de la betalactamasa (el de la resistencia a la ampicilina, que va desde la posición 1625 hasta 2486 nt, es decir, un fragmento de 861 nt) en la secuencia del genoma de pUC19 (2686 nt en total)

5´ TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC 3 ´

Diseño de primers para amplificar el gen de la betalactamasa

Si queremos diseñar primers para amplificar por PCR el gen de la betalactamasa utilizamos el programa Primer design del NCBI

Forward primer 5´TGACGCTCAGTGGAACGAAA 3´

Reverse primer 5´TAGACGTCAGGTGGCACTTT 3´

Estos dos primers amplifican un fragmento de 1140 nt

Vamos a ver donde se encuentran en la secuencia de pUC19: 

5´ TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC 3 ´

OJO para localizar dónde está el reverse primer tenemos que revertir la secuencia del primer para encontrarlo en la secuencia del genoma del pUC19. Me explico:

El Reverse primer es 5´TAGACGTCAGGTGGCACTTT 3´ si buscamos el reverso de esta secuencia obtenemos 5´ TAGACGTCAGGTGGCACTTT 3´

Veamos como quedaría el primer anillado al genoma (en negro es la secuencia correspondiente al genoma y en magenta las secuencias de los primers:

5´ TGACGCTCAGTGGAACGAAAACT……. CCCGAAAAGTGCCACCTGACGTCTA 3´ 

                                                                                         3´TTTCACGGTGGACTGCAGAT 5´


5´TGACGCTCAGTGGAACGAAA 3´

3´ ACTGCGAGTCACC T TGCTTT……………………….TTTCACGGTGGACTGCAGAT 5´   


Referencias

1.  Yanisch-Perron, C.; Vieira, J.; Messing, J. (1985). "Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M13mp18 and pUC19 vectors". Gene. 33 (1): 103–119. doi:10.1016/0378-1119(85)90120-9. PMID 2985470.

miércoles, 25 de agosto de 2021

Purificación del ADN del fago lambda mediante Purelink

 1.    El primer paso es añadir 2 ml del buffer EQ1 en las columnas para que tengan el ambiente iónico adecuado para unir el ADN. Se le da un spin en la centrífuga para que baje el buffer.

Buffer EQ1     0.1 M Acetato sódico pH 5.0 

                                    0.6 M NaCl 

                                    0.15% (v/v) Triton® X-100

2.    Obtenemos los lisados de las bacterias y los fagos que se encuentran en ellos lavando con PBS una placa Petri o si de un cultivo líquido. Determinamos con una pipeta el volume exacto.

3.    Dependiendo del volumen que tengamos del lisado añadimos un volumen de buffer X1 que va entre 30 µL de buffer X1 a 10 mL. Incubamos a 37º C durante 30 min para darle tiempo a la RNasa A y a la DNasa I a degradar el ARN y el ADN respectivamente. El EDTA de este buffer capta los iones metálicos y de esa forma inactiva las metaloproteinasas que podrían estar degradando la cápside proteica de los fagos. 

        Buffer X1 =     100 mM Tris-HCl (pH 7.5)

                                    300 mM NaCl

                                    10 mM EDTA

                                    20 mg/mL RNasa A, 

                                    6 mg/mL DNasa I

4.    Al tubo con la digestion de las nucleasas añadimos 2 mL de buffer X2 a 4ºC e incubo en hielo durante una hora. La alta concentración de sal y el PEG ayudan a condensar los ácidos nucleicos, además, junto con el frio inactivan a las DNasas y RNasas.

        Buffer X2 =     3 M NaCl
                                    30% (w/v) polietileneglicol (PEG) 6000

5.     Para recolectar a los fagos intactos, centrifugamos durante 10 minutes a velocidad máxima (más de 10,000 x g). Desechamos el sobrenadante que contiene los restos de lípidos, proteínas, ADN y ARN de las bacterias lisadas.

6.    Resuspendemos el pellet con los fagos en 1 ml de buffer X3 con una pipeta. El EDTA impide la degradación de metaloproteinasas. El tris mantiene un pH fisiológico

        Buffer X3 =     100 mM Tris-HCl (pH 8.0)
                                    25 mM EDTA

7.    Añadimos 1 mL de buffer X4 a la suspensión de fagos. Mezclamos concienzudamente invirtiendo el tubo varias veces e incubando por 10 min a 70 ºC para disgregar la cápside proteica y liberar los ácidos nucleicos de los fagos.

        Buffer X4 =     4% (w/v) SDS

8.    Añadimos 1 mL de buffer X5 al tubo con los fagos lisados. Mezclamos concienzudamente invirtiendo el tupo y centrifugamos durante10 minutes a temperatura ambiente y 13,000 x g. Los ácidos nucleicos del fago habrán condensado por la acción del acetato potásico 3M, mientras que los restos proteicos de los fagos, o los fagos que todavía están intactos se van a ir al pellet. Tomamos el sobrenadante evitando el pellet y lo aplicamos sobre las columnas que han sido previamente equilibradas en el paso 1. Dejamos que el lisado penetre en la resina de la columna por gravedad. Los ácidos nucleicos se quedarán pegados a la resina

        Buffer X5 =     3.0 M acetato potásico (ajustar el pH 5.5 con ácido acético)

9.    Lavamos la columna para descartar todo aquello que no sean los ácidos  nucleicos adheridos a la matriz de la columna. Lavamos 2 x 2.5 mL con el buffer W8 (Wash Buffer).

Buffer W8 =     0.1 M Acetato sódico (pH 5.0 ajustado con ácido acético)
        (wash buffer)       825 mM NaCl

10.    Eluímos el ADN del fago mediante 0.9 mL de buffer X6. Es el alto contenido en NaCl la que hace que el ADN ya no se adhiera a la matriz de la columna. A este volume se le añade 630 ul de of isopropanol (0.7 del volume previo) a temperatura ambiente. Este paso hace que el ADN se deshidrate y se compacte.

        Buffer X6 =     0.1 M acetato sódico (a pH 5.0 ajustado con ácido acético)
                                    1,5 M NaCl

11.    Centrifugamos el ADN a máxima velocidad 13,000 x g a 4 ºC durante 30 min. Como el ADN de los fagos es pegajoso se pueden fijar a la pared del tubo de centrífuga si el rotor es de ángulo fijo. Por eso es mejor un rotor basculane tipo (i.e. HB-4 or HB-6 para centrífugas Sorval). Como alternativa se pueden usar tubos Corex siliconizados con dimetildiclorosilano.

12. Después de la centrifugación se lava el pellet de ADN con 80% de etanol (así se eliminan sales) y se seca al aire. El ADN se resuspende en agua, TE o 10 mM Tris buffer (pH 8.0).

miércoles, 11 de agosto de 2021

Clonación in silico del gen gyrA de Streptococcus pneumoniae

Vamos a clonar el gen gyrA de S. pneumoniae. Este fue el primer gen que secuencié

Para de la clonación por simulación utilizaremos cuatro herramientas bioinformáticas:

NEBcutter: Es un programa online de la empresa New England Biolabs que comercializa más de 250 enzimas de restricción distintas. Nos permite simular digestión enzimática de moléculas lineales o circulares de ADN.

SerialCloner: Este es una aplicación de biología molecular que permite leer y escribir ficheros en fasta.
Sus herramientas permiten el análisis y visualización de secuencias de ADN, así como la clonación y expresión genética. Dispone de mapas genéticos, mapas de secuencias, visores de fragmentos de ADN. Debemos descargarnos esta app en nuestro computador.

Expasy:
 Programa online del Instituto Suizo de Bioinformática que permite analizar secuencias y estructuras de proteínas. Para nuestro ejercicio introduciremos el plásmido con el gen clonado para averiguar si el ORF está en marco de lectura

Blastp: el ORF localizado por Expasy se puede alinear con otras secuencias de proteínas similares lo que nos dirá de qué proteína se trata

1 Realice una búsqueda en el NCBI del gen que desea clonar y emplee la secuencia del gen en el SerialCloner. Dentro de esta secuencia identifique cual es la secuencia codificadora de la proteína (CDS) (“FIND” y “ORF” pueden ser de ayuda para ello). Una vez encontrada la secuencia, genere otro archivo y guárdelo con el formato (.gb). Genere el mapa de la secuencia de nucleótidos que codifica la proteína que ha elegido y considere los sitios de enzimas de restricción presentes en esta región.
2 Realice una búsqueda en el NCBI o en la página del proveedor de la secuencia de nucleótidos del plásmido a emplear para la clonación y emplee esta secuencia en el SerialCloner. Guarde esta secuencia en su computadora o USB. Genere un mapa con los sitios de enzimas de restricción y sitios relevantes para expresión que va a emplear para construir su plásmido recombinante.

3 Realizar la PCR: Continúe con la creación de primers para emplear en la futura reacción de PCR.
Forward primer: Puede seleccionar unas bases de inicio de la secuencia de nucleótidos codificadora de la proteína (CDS) y copiar y con ellas crear su primer adicionando bases adicionales al inicio del primer y la secuencia de enzima de restricción.
Forward Primer (FP)= 5’ Extra bases + Enzima de restricción + Secuencia idéntica al CDS 3’ 
Reverse Primer (RV)= 5’ Extra bases + Enzima de restricción + Secuencia reversa y complementaria al CDS 3’

Las bases extras se colocan para mantener el Open Reading Frame adecuado para la producción de la proteína y además dar estabilidad para la complementariedad del primer. La secuencia que contenga la enzima de restricción es la que se pretende emplear para la digestión del plásmido.

Para realizar el PCR, abra una ventana en el programa SerialCloner desde la barra superior del software opción de “PCR”; una ventana emergerá donde se colocarán los primers. En:
“Oligo tail not identical to the target sequence” → extra bases y enzima de restricción
“Segment identical to the target sequence” → FP Secuencia idéntica de inicio del CDS, RP Secuencia reversa y complementaria del final del CDS

Otra alternativa para crear los primers sin la secuencia de enzima de restricción es usar de la Barra de herramientas “Edit” y “Use as PCR Reverse Primer” o “Use as PCR Forward Primer” 
En la “Opción Select the target Sequence” seleccione la secuencia de CDS (guardado en el paso 2) y corra la PCR. Una nueva ventana emergerá con el producto del PCR, guarde este archivo.

4 De la barra de herramientas seleccione “Construct”. En la ventana que emerge seleccione en “Fragment 1” cargue el archivo del plásmido (guardado en el paso 3). Encuentre las enzimas a emplearse para digestión y de un click en la enzima de restricción del extremo 5’ del PCR y doble click en la enzima de restricción del extremo 3’ del PCR. En la sección “Fragment 2” cargue el archivo guardado en el paso 4 (producto de PCR). Encuentre las enzimas a emplearse para digestión y de un click en la enzima de restricción del extremo 5’ del PCR y doble click en la enzima de restricción del extremo 3’ del PCR. Y pulse “Ligate”

5    Vamos con un caso práctico: En una práctica previa hemos amplificado el gen gyrA de Streptococcus pneumoniae de manera que el fragmento amplificado está ahora flanqueado por dos dianas para enzimas de restricción: 

BamHI GGATCC

XbaI TCTAGA


Nos asegurarnos que estas dianas son únicas, es decir, que solo van a estar presentes en los extremos del fragmento de PCR que amplificó nuestro gen de interés y que en el vector de clonación están solo en copia única. ¿Cómo podemos saberlo? Introducimos el archivo fasta de nuestro gen en NEBcutter y entre las opciones del programa podemos ver las secuencias de las enzimas que van a cortar nuestro fragmento y también qué enzimas no van a tener dianas en el gen a clonar. Debemos ver también que las enzimas que vamos a utilizar para clonar no deben de estar en nuestro vector: pcDNA3.1(+). Haz clic para obtener su secuencia en formato fasta.

Se abre un documento nuevo en  el programa SerialCloner 2.6. Se pega la secuencia de la gyrA. Se salva el documento con un formato compatible (.xdna). Se hace lo mismo con la secuencia del vector. Seguidamente se procede a hacer la construcción del plásmido recombinante. Para eso, se debe dar clic en el icono Construct. Se abre una ventana donde aparecen tres subventanas: fragment #1 vector fragment; fragment #2; fragment #3.

En la ventana de fragment #1 seleccionaremos la secuencia del vector. En la del fragment #2 seleccionaremos la secuencia del fragmento de nuestro gen de interés. Presionas la opción ligate y observas en la ventana que aparece y observarás lo siguiente
así como en el Graphic Map que el resultado corresponde al vector digerido con las enzimas BamHI y XbaI ligado con el fragmento correspondiente al gen gyrA amplificado por PCR con las enzimas BamHI y XbaI y digerido con ambas enzimas. El resultado es un plásmido de 5640 pares de bases.

6    Si copiamos su secuencia, la del plásmido más el inserto y la introducimos en la función Translate de Expasy nos permite ver si el gen clonado tiene sentido cuando en la bacteria se exprese a proteínas
7    Puedes comprobar que esa proteína se corresponde con la proteína que querías clonar si haces un alineamiento con Blastp y compruebas que efectivamente esa secuencia corresponde al gen de interés.

Pero... ¿y si no obtienes un plásmido de 5640 pares? ¿Cuál es el error?

Quizás el error ha sido utilizar el fasta de gyrA pero no el fasta del gyrA amplificado por PCR al que se le ha adicionado las dianas para las enzimas de restricción BamHI y XbaI. Si utilizamos este fasta entonces tendremos éxito con la clonación ¿Puedes explicar por qué?

El plásmido PBLUESCRIPT ii sK (+/-) tiene un tamaño de 2961 nt pero después de la digestión con BamHI y XbaI queda linearizado y de un tamaño de 2955 nt:  tctagagcggccgccaccg /.../ cagcccgggggatcc

 ¿Puedes explicar por qué?

El fragmento amplificado del gen gyrA al que le hemos adicionado las dianas de restricción BamHI y XbaI así como 4 nt extra en cada extremo: GCGCGGATCCTTTTAAAAA /.../ CTGTCACTCTAGAGCGC mide 2705 nt, después de su digestión enzimática ¿Con cuántos nt quedaría?

Si después de realizar el ejercicio tienes un plásmido recombinante pBluescript II Sk + gyrA de 5640 nt ENHORABUENA. Y si no, sigue intentando :)

Rúbrica: 
REFERENCIAS:

domingo, 1 de agosto de 2021

Que todo el mundo se vacune al mismo tiempo

 La actual administración de los EEUU apoya liberar las patentes de las vacunas para frenar la expansión del Sars-CoV2. Es una medida inteligente. O nos vacunamos todos o la vacunación será solo efectiva hasta que aparezcan nuevas variantes del virus.

Los virus cuando circulan el la población van acumulando mutaciones. Si el material genético es como una frase, las mutaciones aparecen espontáneamente, lo mismo que a las frases que dicen los niños cuando juegan al teléfono estropeado.  Si esta mutación que aparece beneficia a que el virus se transmita de manera más eficiente, el nuevo virus va tener cada vez más y más población. Es lo que se llama selección clonal. En la línea de tiempo se ve como la población naranja es sustituida por una población amarilla y de repente se selecciona una mutación que hace que sus descendientes sean muy distintas a la población naranja original. Es ahí cuando la vacuna que se diseñó contra la población naranja deja de funcionar frente a la gris. Por ese motivo, es importante que TODO el mundo se vacune al mismo tiempo, para que el virus deje de circular y de acumular mutaciones.

Entre 1959 y 1962, un demócrata de Arkansas llamado Estes Kefauver supervisó una investigación sobre la industria farmacéutica de la posguerra llegó a la conclusión que: "márgenes de beneficio de hasta el 7.000% en medicamentos patentados cuya creación implicaba procesos naturales descubiertos en laboratorios financiados con fondos públicos"

En este fantástico artículo que recomiendo leer se describe como las vacunas pasaron de ser conocimiento libre a estar protegidas por patentes. Un proceso bastante reciente como vamos a poder ver. Drahos y Braithwaite, en su libro "Feudalismo de la información" describen como después del desmoronamiento de la URRS en 1989, los Estados Unidos entraron en un periodo de dominio históricamente único, y Moscú desapareció como fuente de apoyo material e ideológico para los países de la oposición anti-ADPIC (Aspectos de los Derechos de Propiedad Intelectual relacionados con el Comercio). La ciencia y la transferencia de tecnología soviéticas habían contribuido a sentar las bases de las industrias de medicamentos genéricos en todo el sur del mundo. A partir de ese momento se hizo presión a las naciones para que firmasen el tratado de libre comercio de el 15 de abril de 1994, cuando 124 Estados firmaron el tratado que dio origen a la OMC.

Una docena de años más tarde, un crítico tan sofisticado de los ADPIC como Joseph Stiglitz escribiría: “mientras firmaban los ADPIC (que son las bases en donde se sustenta la defensa de las patentes sobre los medicamentos en el tratado de libre comercio), los ministros de comercio estaban tan satisfechos de haber alcanzado por fin un acuerdo que no se dieron cuenta de que estaban firmando una sentencia de muerte para miles de personas en los países más pobres del mundo”.

los ADPIC "Aspectos de los Derechos de Propiedad Intelectual relacionados con el Comercio"que son las bases en donde se sustenta la defensa de las patentes sobre los medicamentos en el tratado de libre comercio son de 1994. Del mismo año en el que nació Justin Bieber. Ver fuente

Y no solo eso. Si no vacunamos a todo el mundo en un plazo de tiempo razonable el virus quedará circulando en esas comunidades no vacunadas. Al transmitirse de una persona a otra irán apareciendo nuevas variantes que harán que las vacunas que se administraron hace dos años no nos protejan de las nuevas variantes del virus. Respecto a la vacunación no debemos dejar a nadie atrás

Fuente: https://newrepublic.com/article/162527/long-strange-trips-grubby-history-vaccines-became-intellectual-property