miércoles, 30 de marzo de 2022

¿Para qué vive un protozoo?

Entrada dedicada a Verónica Castro, autora de la pregunta

Hay preguntas tan buenas que suponen el 50% de la respuesta. ¿Para qué vive un protozoo? es una de ellas. La persona que la formuló lo hizo desde el desconocimiento de la biología, por eso es tan interesante. 

Protozoo agarrándose a la vida. Autor Esteban Fernández

Ver a un protozoo afanándose por vivir, agarrándose a la vida, desde una mirada sin prejuicio hace que te preguntes ¿Para qué vive? ¿Por qué se toma tantas molestias?. Hay en esta pregunta algo de humanocentrismo
El actor gallego Manuel Manquiña en el minuto 0.29 nos explica qué es el humanocentrismo. Fuente: Ilustres Ignorantes: La Prensa | #0

Y es precisamente ese humano centrismo lo que la hace interesante. Me explico. En este blog ya he explicado cómo los humanos somos protozoos venidos a más. Si nosotros somos capaces de definir para qué vive un protozoo y eliminamos esos motivos "protozoarios" de nuestras vidas podremos definir qué es lo que nos hace humanos.

Un ser vivo, desde un punto de vista biológico, no es más que un código que se replica. Al replicarse genera una descendencia numerosa. Esa descendencia no será toda igual. Algunos tendrán más éxito a la hora de reproducirse que otros. Con el tiempo dejarán más descendencia. Por lo tanto, aquellos códigos que optimicen su relación con el medio y ésto les permita dejar más descendencia, serán los que perduren en la línea de tiempo. El sexo es una actividad protozoaria, el amor no. El instinto de protección de los hijos es protozoario, biológico, el entenderlos como personas eso va más allá de los instintos.  

domingo, 20 de marzo de 2022

Gestación subrogada: ¿Parasitismo o simbiosis?

 


Este argumento se sostiene en el hecho de que las únicas células que tienen la posibilidad de perdurar en el tiempo son las células sexuales. Células, que son por cierto, unicelulares. La parte somática, es decir, no sexual, constituida por células clónicas del zigoto diploide, todas esas células están destinadas a formar un cadáver. Producimos gametos haploides (óvulos y espermatozoides) toda nuestra vida reproductiva adulta con la esperanza de que encuentren a su background genético, un espermatozoide para el óvulo o viceversa, y vuelta a empezar. El tiempo para las células sexuales es circular, para las células somáticas es lineal. Desde ese punto de vista, el humano es un portador de células sexuales hasta la siguiente generación. 

¿Podemos analizar la gestación subrogada desde un punto de vista biológico?

La gestación subrogada se suele contemplar desde dos puntos de vista: el ético y el liberal. 

Desde el punto de vista ético, la mayoría de las opiniones son contrarias a la gestación subrogada. Se considera un abuso contra la mujer porque los progenitores de intención se aprovechan de la condición de necesidad económica de las gestantes. Desde el punto de vista liberal, la mayoría son favorables: es un acuerdo libre y consensuado entre los futuros progenitores dispuestos a pagar por el alquiler de un vientre en el que se desarrolle su zigoto fecundado y la gestante.

Desde el punto de vista biológico caben dos opciones: el parasitismo y la simbiosis. Parasitismo porque hemos visto como uno de las características del parasitismo es el "quítate tu pa ponerme yo". No se compite, se accede al espacio, al territorio del otro para medrar y propagarse uno mismo. El otro, la simbiosis, hace hincapié en el hecho de que esa acción parasitaria tiene una contraprestación económica. ¿Qué es el dinero para esas gestantes? la posibilidad de poder vivir y poder mantener a sus hijos o a sus futuros hijos. 

Si no hubiese dinero de por medio, la gestación subrogada podría ser de tipo altruista, como se da de hecho y está legislada en muchos países.

¿Los hijos? ¡Mis parásitos favoritos!

La estructura parasitaria es algo que todavía no tenemos en mente cuando nos enfrentamos a problemas biológicos. Una de las ideas que trato de inculcar en mis alumnos es que las células sexuales son las únicas células vivas de nuestro cuerpo porque son las únicas que se van a mantener en el tiempo. La parte somática de nuestro cuerpo, es decir, lo que somos nosotros, vivimos exclusivamente para mantener a nuestras células sexuales vivas hasta la siguiente generación. 

Las células sexuales, como protozoos parásitos que son, nos manipulan, hacen que con la pubertad se nos vuelva imperioso fijarnos en el otro sexo, que busquemos procrearnos. Como buenos zombis en manos de esos protozoos egoístas, ponemos todo de nuestra parte para que crezcan sanos, para que tengan la mejor formación. Procuramos, como buenos padres, lo mejor para nuestros hijos.

Todo ese esfuerzo por salir, gustar, ser atractivo, no es más que esa pulsión por buscarle a uno de tus protozoos sexuales el background genético que les permita crear un "carrier biológico" a tus células sexuales, lo que viene a ser sus hijos y tus nietos. Mientras están en esa tarea, los hijos son egoístas, todo les parece poco. Luego vendrá la toma de conciencia que llega cuando te conviertes a tu vez padre y comprendes todo lo que ellos han hecho por ti. Ser padre te vuelve más humano. La piedad filial surge cuando, de mayor, te das cuenta de que gran parte de tu vida has sido un parásito de tus padres. Es en ese momento que reparas en esas personas que te entendieron y te apoyaron, que te amaron más allá de la biología. 

Ligar, salir a buscar pareja, es el esfuerzo de ese protozoo por salir de un cuerpo que, genéticamente, sabe que tiene el tiempo contado. Para esa célula sexual, ese protozoo parásito, nada importa más que la transmisión. Por eso somos miles de millones. 

La explicación biológica es limitada y presenta problemas

Existen sesgos ideológicos en las teorías sobre la evolución del sexo. Esto es debido a que la sociobiología es una ciencia blanda. Las ciencias blandas pueden utilizar el método científico pero en algunos casos llegan a conclusiones teóricas únicamente a través de razonamientos, sin ser posible la experimentación

Y mejor que no haya experimentación. Al menos en humanos. Los médicos nazis llegaron a probar cuanto aguantaban los instintos maternales de enfermeras y matronas cuando les entregaban niños que, por medio de una intervención quirúrgica, no paraban de llorar. Con satisfacción sádica comprobaban que acababan matando a esos bebés. La explicación a este comportamiento es que el lloro del bebé activa nuestros centros de estrés para que calmar ese lloro se convierta en nuestra prioridad. Si no puedes calmarlo, el estrés que te produce es superior a tu sentido de protección de un bebé. 

Los mamíferos estamos programados instintivamente para proteger a los animales con cabeza y ojos grandes, por ese motivo se dan casos de leonas que amamantan temporalmente a los bebés de los animales que acaban de matar. Al final, cuando tienen hambre acaban matando también a esos bebés. 

El principal problema no de la ciencia sino del cientificismo es el reduccionismo. Llegar a creer que el ser humano es un protozoo. Explicarnos, desde ese cientificismo reduccionista como máquinas, como materia es empobrecernos. Hay una "explicación" biológica, y ojo, una explicación en el fondo no es ciencia. Esa "explicación" lo único que logra es minimizar la responsabilidad ética en nuestras acciones. Lo que nos hace humanos no es la biología. La biología es una base material, exclusivamente. Lo que nos define como humanos va mucho más allá.

sábado, 19 de marzo de 2022

Exponentes y logaritmos en microbiología

En diez años que van desde los 5 a los 15, estudiamos matemáticas una media de 5 horas a la semana. El curso suele tener 40 semanas. 5 x 40 x 10 = 2000 horas de aprendizaje. Mis alumnos de medicina saben a duras penas sumar, restar, multiplicar y dividir. ¿Reglas de tres? tengo grupos de alumnos que le han dedicado 25 minutos a resolver sin éxito una regla de tres. Digo 25 minutos por que de la desesperación he acabado yo resolviéndola. 

Los profesionales de la educación han llamado a esto: anumerismo.  Saber pocas matemáticas nos convierte en ciudadanos más manipulables. El desconocimiento de los números carece del reproche social que provocan otras ignorancias. Una buena parte de las confusiones provienen de nuestra dificultad para manejar cifras muy grandes. La dificultad para manejar el concepto de números exponenciales también es un obstáculo para entender cómo funcionan las vacunas.

Creo que los profesores de matemáticas cometen un error: avanzar, tratar de dar el temario sin darse cuenta que en la mayoría de los casos los alumnos no han llegado al mugido del conocimiento. ¿Se imaginan un curso en el que todo lo que se va a dar de matemáticas ese curso sea cálculo exponencial? solo exponentes y logaritmos. Si realmente aprendiesen de una vez por todas a manejar lo exponencial podríamos pasar a otras habilidades matemáticas. 


Las bacterias crecen de manera exponencial, de una pasan a dos, de dos a cuatro, de cuatro a ocho y así sucesivamente.
Si una bacteria se divide 10 veces tendremos 210 = 1024. Si nos dicen que tenemos 1024 bacterias y queremos saber cuantas veces se ha dividido a partir de una bacteria tendremos que utilizar el logaritmo en base 2:

Log 2 (1024) = 10

 ¿Cómo cambiar la base del logaritmo en la calculadora?

En la calculadora científica existen dos teclas para resolver logaritmos:
La tecla «log» que sirve para resolver logaritmos de base 10
La tecla «ln» que sirve para calcular los logaritmos neperianos (en base e)
Es decir, directamente con la calculadora, sólo se pueden resolver logaritmos en base 10 o logaritmos neperianos. No podemos cambiar la base del logaritmo en la calculadora.
Por eso, si necesitamos resolver un logaritmo de cualquier otra base, necesitamos aplicar la fórmula del cambio de base.
¿Y qué es la fórmula del cambio de base?
La fórmula del cambio de base nos permite calcular logaritmos de cualquier base con la calculadora. Es la siguiente:
Lo que viene a decir esta fórmula es que si tenemos el logaritmo en base «a» de un número N, podemos elegir otra base «b», que puedes ser la que queramos y dividir el logaritmo en esa base «b» del número entre el logaritmo en esa base del número «a» («a» es la base del logaritmo original).

Fórmula del cambio de base con logaritmos en base 10
Como podemos elegir la base «b» que queramos, vamos a jugar con eso a nuestro favor y vamos a elegir una base que nos convenga, como es la base 10, que es la que tenemos en la tecla «log» de la calculadora para resolver logaritmos.
Eligiendo la base 10, la fórmula del cambio de base queda mucho más simplificada:
Ahora, el logaritmo en base «a» de un número N es igual al logaritmo de N entre el logaritmo de «a» (ambos en base 10. Al estar en base 10, ya podemos resolverlos con la calculadora y la fórmula se convierte en una simple división.
Vamos a verlo con un ejemplo: Resolver el siguiente logaritmo:
Tenemos que resolver el logaritmo en base 7 de 100.
Aplicamos la fórmula del cambio de base y nos queda que ese logaritmo, «log N» es el logaritmo de 100 y «log a» es el logaritmo de 7, que es la base del logaritmo original.
Hallamos el valor de cada uno con la calculadora y realizamos la división, obteniendo el valor del logaritmo original:
¡Funciona!
Tienes que sólo tienes que dividir el logaritmo del número entre el logaritmo de la base del logaritmo original.
Existe una alternativa y es descargar Photomath en tu celular. Se escanea la fórmula y ¡Ya!
Fórmula del cambio de base con logaritmos neperianos

Como tenemos la tecla «ln», que también resuelve logaritmos, podemos utilizar la fórmula del cambio de base eligiendo la base e, es decir, los logaritmos neperianos, quedando de la siguiente forma:
El logaritmo en cualquier base de un número es el logaritmo neperiano del número entre el logaritmo neperiano de la base del logaritmo original.

Vamos a ver otro ejemplo resolviendo un logaritmo con la fórmula del cambio de base con logaritmos neperianos. Tenemos que resolver el logaritmo en base 5 de 123. El logaritmo en base 5 de 123 es igual al logaritmo neperiano de 123 entre el logaritmo neperiano de 5. Estos logaritmos neperianos ya los podemos resolver con la calculadora. Resultado 2.98.

viernes, 18 de marzo de 2022

Proyecto de investigación propuesto por un alumno

 Las siguientes imágenes corresponden a un proyecto de investigación propuesto por un alumno. ¿Qué críticas podrías hacerle?









Cromosomas circulares y lineales: lo eterno y lo finito

 Las procariotas como arqueobacterias y las eubacterias (Gram-positivas y Gram-negativas) tienen cromosomas circulares. Es una diferencia entre las procariotas y las eucariotas que tienen cromosomas lineales. 

Cromosoma circular bacteriano ordenado en dominios (bucles). Fotografía de microscopía electrónica. Fuente

Existía la creencia de que las bacterias tenían un solo cromosoma circular, aunque podían tener plásmidos, que vendrían a ser cromosomas circulares bastante más pequeños. Se decía que estos plásmidos no eran cromosomas porque eran prescindibles. Hoy sabemos que existen bacterias con muchos cromosomas. También hemos visto plásmidos que tienen genes esenciales para la bacteria. 

El genoma de Deinococcus radiodurans es inusual: está compuesto de dos cromosomas, de un megaplasmido y de un plasmido pequeño. Al tener múltiples copias de su genoma, D. radiodurans puede sobrevivir las altas dosis de la radiación al poder arreglar las roturas múltiples de la DNA inducidas por los altos niveles de radiación mediante copias intactas de su genoma. 

Agrobacterium tumefaciens son bacterias ubicuas, Gram-negativas, motiles, de tierra. Son capaces de transferir suj ADN a células de plantas. Su genoma circular es aproximadamente de 5.7 Megabases (Mb) y además de eso tiene un cromosoma linear y de dos plasmidos. Uno de los plasmidos, designado como el plasmid Ti, que induce la formación de tumor, es responsable de virulencia de Agrobacterium tumefaciens. ¿Un cromosoma lineal?

Sí, existen cromosomas lineales en bacterias

La mayoría de los cromosomas bacterianos muestran una geometría circular. Sin embargo, algunas especies de bacterias presentan cromosomas lineales: Inicialmente descubiertos en Borrelia burgdorferi, se han encontrado también en 14 especies adicionales del género Borrelia, cuatro especies del género Streptomyces, en Rhodococcus facians (revisado en Casjens, 1998; Cole y Saint-Girons, 1999), así como en tres especies del género Agrobacterium (Jumas-Bilak y col., 1998) y, probablemente, en algunas especies del género Azospirillum (Martin-Didonet y col., 2000).

La presencia de replicones lineales en tantos grupos filogenéticamente diversos sugiere que éstos se han generado varias veces de manera independiente. Sin embargo, esto no significa que estos grupos se hayan especializado solamente para la replicación de moléculas lineales. Por ejemplo, Borrelia burgdorferi, además de mantener un cromosoma y varios plásmidos lineales, también posee plásmidos circulares (Casjens y col., 2000). La coexistencia en la misma célula de replicones circulares y lineales se presenta también en Agrobacterium, Azospirillum y Streptomyces. Aún Escherichia coli, en donde el cromosoma y la virtual totalidad de sus plásmidos son circulares, puede mantener al profago N15, el cual es lineal (Rybchin y Svarchevsky, 1999).

Los cromosomas lineales y el tiempo finito

Uno de los problemas de los cromosomas lineales son cómo mantener intacta su longitud. Para eso se desarrollaron los telómeros y la telomerasa. Las células sexuales tienen telómeros y telomerasa que se encarga de que a pesar de sus continuas divisiones, el número de telómeros no disminuya. Las células somaticas carecen de telomerasa y el número de telómeros mide y regula el número de divisiones celulares. Los telómeros se acortan con cada división celular y el número de divisiones que la célula puede experimentar se correlaciona con la longitud de los telómeros. Este acortamiento pudiera eliminar genes indispensables para la vida o silenciar genes cercanos por el efecto de posición del telómero. Una longitud crítica pudiera ser la señal para la entrada en la senescencia celular.

El tiempo cíclico tiene, en esencia, la particularidad de no tener un principio y un final. El tiempo lineal, que es una creación de las sociedades agrícolas del neolítico, tiene la particularidad de "ir hacia delante" y nunca retornar.

Desde estas páginas, he intentado explicar varias veces que los humanos somos, desde un punto biológico, protozoos venidos a más. Este argumento se sostiene en el hecho de que las únicas células que tienen la posibilidad de perdurar en el tiempo son las células sexuales. Células, que son por cierto, unicelulares. La parte somática, es decir, no sexual, constituida por células clónicas del zigoto diploide, todas esas células están destinadas a formar un cadáver. Producimos gametos haploides (óvulos y espermatozoides) toda nuestra vida reproductiva adulta con la esperanza de que encuentren a su background genético, un espermatozoide para el óvulo o viceversa, y vuelta a empezar. El tiempo para las células sexuales es circular, para las células somáticas es lineal.

Mi hipótesis es que los cromosomas lineales aparecieron en las células eucariotas por que presentaban tres ventajas: 
1 Podían acumular más información genética
2 Podía haber múltiples cromosomas y al segregarse aumentar la variabilidad genética de las células sexuales
3 Los cromosomas lineales de las células somáticas que carezcan de telomerasa tienen un número finito de divisiones posibles. Es como un seguro de caducidad que protege al organismo de células cancerosas que por mutación empiecen a dividirse sin control

miércoles, 16 de marzo de 2022

Cómo detectar Porphyromonas gingivalis

La Diversidad de cepas en Porphyromonas gingivalis han demostrado que las cepas de P. gingivalis varían en su virulencia (destrucción y muerte de tejidos blandos) en modelos animales, y algunas cepas se clasifican como virulentas, por ejemplo, las cepas W83, W50, ATCC 49417 y A7A1, y otras se clasifican como avirulento, por ejemplo, cepas 381, 33277 y 23A4

Virulentas

ATCC 49417 9 publicaciones
ATCC A7A1 6 publicaciones
ATCC W83 73 publicaciones
ATCC W50 45 publicaciones. Cepa "wild type"

Avirulentas

ATCC 33277 342 publicaciones. Se usa como cepa tipo. En esta publicación se analizó el diferente perfil genético en biofilms versus células plantónicas.

ATCC 381 119 publicaciones

Colonias de P. gingivalis cultivadas en agar sangre. El hemo del medio es oxidado por las bacterias para producir hemina que se acumula en la superficie celular produciendo un pigmento negro característico después de aproximadamente 7 días de incubación anaeróbica. Fuente

Gen HmuY de Porphyromonas gingivalis 

ATCC 33277, NCBI Reference Sequence: NC_010729.1

>NC_010729.1:c610707-610057 Porphyromonas gingivalis ATCC 33277, complete sequence

ATGAAAAAAATCATTTTCTCCGCACTCTGTGCATTGCCATTGATTGTGTCTCTAACTTCTTGTGGGAAGAAGAAAGACGAGCCGAACCAACCCTCCACACCCGAAGCAGTAACCAAAACCGTAACTATCGATGCTTCGAAATACGAAACGTGGCAGTATTTCTCTTTTTCCAAAGGTGAAGTCGTAAATGTTACCGACTATAAGAACGATTTGAACTGGGACATGGCTCTTCACCGCTATGACGTTCGTCTCAATTGTGGCGAAAGTGGCAAGGGAAAAGGTGGTGCCGTATTCTCCGGCAAGACAGAAATGGATCAGGCTACTTCCGTTCCGACAGACGGATATACCGTAGATGTTCTCGGCCGTATTACAGTCAAGTACGAAATGGGACCTGATGGTCATCAGATGGAATATGAAGAACAGGGCTTCAGCGAAGTGATTACCGGCAAGAAGAACGCACAGGGATTTGCTTCAGGTGGTTGGCTGGAATTCTCTCACGGTCCTGCCGGTCCCACTTACAAGCTGAGCAAAAGAGTCTTCTTCGTTCGTGGTGCTGATGGTAATATTGCCAAAGTGCAGTTCACTGACTATCAGGATGCAGAACTCAAAAAAGGAGTCATCACTTTCACTTATACATACCCCGTTAAATAA

El gen HmuY es una proteína de unión al hierro que es característica de Porphyromonas gingivalis. Por ese motivo, ha sido seleccionada para detectar mediante PCR esta bacteria.

Diagrama de la amplificación isotérmica LAMP. Fuente

Para diseñar primers para una amplificación isoterma usando LAMP la página de NEB.primers nos da el siguiente resultado:

F3_P7 TCCGACAGACGGATATACCG
B3_P7 ACCACGAACGAAGAAGACTC
FIP_P7 TCGCTGAAGCCCTGTTCTTCATTCTCGGCCGTATTACAGTCA
BIP_P7 ACGCACAGGGATTTGCTTCAGGGCTTGTAAGTGGGACCGG

Dado que P. gingivalis es una bacteria anaerobia, podría ser interesante ampliar un fragmento que contenga el gen para utilizarlo como template en las amplificaciones de LAMP

Para ello, escogemos un fragmento del genoma completo de P. gingivalis ATCC 33277 que es la bacteria que tenemos en nuestro laboratorio, ese fragmento va desde la posición 610000 a la 610757

>NC_010729.1:610000-610757 Porphyromonas gingivalis ATCC 33277, complete sequence
AAAGCAGGCCGATGAGGGCCTGCTTTGTTACTACACTTTTCATATTTCCCTCTTAACTTATTTAACGGGGTATGTATAAGTGAAAGTGATGACTCCTTTTTTGAGTTCTGCATCCTGATAGTCAGTGAACTGCACTTTGGCAATATTACCATCAGCACCACGAACGAAGAAGACTCTTTTGCTCAGCTTGTAAGTGGGACCGGCAGGACCGTGAGAGAATTCCAGCCAACCACCTGAAGCAAATCCCTGTGCGTTCTTCTTGCCGGTAATCACTTCGCTGAAGCCCTGTTCTTCATATTCCATCTGATGACCATCAGGTCCCATTTCGTACTTGACTGTAATACGGCCGAGAACATCTACGGTATATCCGTCTGTCGGAACGGAAGTAGCCTGATCCATTTCTGTCTTGCCGGAGAATACGGCACCACCTTTTCCCTTGCCACTTTCGCCACAATTGAGACGAACGTCATAGCGGTGAAGAGCCATGTCCCAGTTCAAATCGTTCTTATAGTCGGTAACATTTACGACTTCACCTTTGGAAAAAGAGAAATACTGCCACGTTTCGTATTTCGAAGCATCGATAGTTACGGTTTTGGTTACTGCTTCGGGTGTGGAGGGTTGGTTCGGCTCGTCTTTCTTCTTCCCACAAGAAGTTAGAGACACAATCAATGGCAATGCACAGAGTGCGGAGAAAATGATTTTTTTCATAATTATCTGACCTTACTTTTAATAGGTTTCATCCGGCTGCAAAGTTGAGA

Primer forward: 5´GGGCCTGCTTTGTTACTACAC 3´
Primer reverse: 5´TGCAGCCGGATGAAACCTATT 3´

Tomar muestras de P. gingivalis con puntas de papel

Puntas de papel para toma de muestras. Fuente
Como sembrar y cultivar anaerobiamente. Fuente

Las colonias obtenidas se pueden identificar por Viteck–2 usando las tarjetas ANC. También se puede utilizar el Maldi-TOF.

Amplificar el gen mediante LAMP

La reacción LAMP para la detección de P. gingivalis se llevó a cabo usando una amplificación de ADN Loopamp kit (Eiken Chemical Co., Ltd., Tochigi, Japón) en 25 ul volumen. La mezcla de reacción contenía 40 pmol cada uno de FIP y BIP, 5 pmol de cada uno de los cebadores F3 y B3c,
2 lu de ADN de la bacteria, 1 ul de Bst ADN polimerasa y 12,5 ul de mezcla de reacción preparada en el kit. La mezcla de reacción se incubó a 60, 62, 64 o 66ºC durante 30 o 60 min. Después de la incubación, la reacción se terminó calentando la mezcla de reacción a 80ºC por 2 minutos

Detección a simple vista por SYBR Green

Para detección a simple vista, se añadió a la mezcla de reacción 1,0 ul de SYBR Green I diluido  10-1 o 10-3  (Takara Bio Inc., Otsu, Japón). El cambio de color se observa a simple vista. La inspección del tubo con SYBR Green I diluido 10-3  se realizó bajo luz UV (longitud de onda de 302 nm). El cambio de color de las muestras con SYBR Green diluidas  10-1 se ven bajo luz natural.


Inspección a simple vista de las reacciones positivas (Pg 20 y Pg200) y negativas (Pg -) de la amplificación LAMP. a) El color naranja original de SYBR green del control negativo se torna en verde en el control positivo. b) la fluorescencia de la unión al ADN al  SYBR green I se detectó visualmente bajo luz ultravioleta. La detección límite de ambas inspecciones a simple vista con SYBR green I fue inferior a 20 células (Pg20). c) La reacción LAMP también se inspeccionó a través de blanco
turbidez del tubo causada por el pirofosfato de magnesio, un subproducto de LAMP. El límite de detección de la turbidez blanca fue a 200 células (Pg200). Fuente

Reactivos

martes, 15 de marzo de 2022

¿Realmente sabemos cómo funcionan las vacunas?

PREGUNTAS PREVIAS AL TALLER

PREGUNTA 1: ¿Por qué la vacuna nos protege contra virus y bacterias?

RESPUESTAS INCORRECTAS:

Básicamente, existen diferentes virus y bacterias que tienen la capacidad de entrar en el ser humano, una vez adentro se desencadena una serie de cosas empezando porque se multiplica para así atacar a las células causando una infección, el virus o bacteria el sistema inmunológico la identifica como raro y para protegerse se da la respuesta inmune innata, es decir, los macrófagos pues se comen a los invasores para destruirlos y si eso no funciona la otra opción es los linfocitos que son como detectives usando el antígeno, cada uno de ellos desarrolla una forma para atacarlos, se multiplica, los B producen anticuerpos ayudando a los macrófagos a que si eliminan estos invasores. Las vacunas actúan en el sistema inmunológico para así combatir la infección introduciendo algún germen muerto o viejo, evitando que se dé la enfermedad. (Por K. L.)

Cuando se aplica una vacuna, esta va a estimular una respuesta inmunitaria, a manera de una memoria, cosa que en el caso que es el futuro la persona inoculada “……” ese virus, su sistema inmune que sebe como actuar, y hace que la enfermedad no sea letal, y su sintomatología es más leve. (Por D.N.)

Cuando hay una infección, el sistema inmunitario activa 2 mecanismos de defensa. Las vacunas trabajan en conjunto con el sistema inmunológico, ya que los linfocitos tienen memoria y reaccionan si el mismo virus o patógeno viral aparecen. Las vacunas simulan una infección y como crea memoria contra estos patógenos, así que al momento de entrar el sistema inmune ya está “entrenado”. (Por M. A. P.)

La vacuna se encarga de simular la infección, pero sin producirla, empieza con la inoculación de ARN muerto o inactivo que va a estimular la producción de anticuerpos específicos o linfocitos B idénticos para que a futuro reconozcan el antígeno lo ataque a futuro. Se necesita refuerzo porque va perdiendo esta carga al generar una respuesta adaptativa con especificidad. (Por P.C.)

Las vacunas tienen partes inactivas o una fracción de un organismo específico (antígeno) que va a provocar una respuesta inmunitaria en el cuerpo. Entonces al introducirla produce más antígenos nuestro cuerpo porque lo reconoce y quedan como defensa adquirida. En caso de infección el cuerpo ya la reconocería. Cabe recalcar que esta no provoca la enfermedad, pero inducirá al sistema inmunitario a responder como lo hubiera hecho en su primera reacción ante el patógeno real. (Por C.R.)

 

Cómo funcionan las vacunas | AFP Animé.

PREGUNTA 2: Atención al minuto 0:50 ¿Es correcto decir que el linfocito "se adapta" para atacar a un virus o una bacteria en particular? ¿Qué crees que quiere decir?

RESPUESTAS INCORRECTAS (Todos los alumnos encuestados respondieron que no se adaptan porque previamente les había dicho que es horrible decir que se adaptan... pero ninguna de las respuestas fue más allá de razonamientos circulares y lugares comunes): 

El linfocito no se adapta, como los linfocitos adquieren memoria estos adquieren especificidad lo que permite reconocer al mismo virus si es que vuelve a entrar. (Por M.A.P.)

No se adapta. Si la bacteria no es reconocida pues no habrá nada contra ella, pero en caso de reinfección y la reconocería y sabría cómo atacar. (Por R.F.)

No, puesto que las vacunas al crear una respuesta adaptativa inducen especificidad para que los linfocitos reconozcan y ataquen. (Por P.C.)

Los linfocitos no se adaptan, pero tienen memoria, entonces cuando un virus o bacteria aparece ellos lo identifican, indicando especificidad para ellos. (Por K.L.)

¿Cómo funciona la vacuna contra el COVID-19?. Fuente AstraZeneca

PREGUNTA 3: Atención al min 2:30 ¿Crees que explica cómo funcionan las vacunas cuando dice que los linfocitos después del contacto con el antígeno se multiplican? 

-------------------------------------------------------------------------------------------------------------------------

La gran mayoría, por no decir todos, los alumnos no respondieron de manera correcta estas preguntas

¿Puede ser el anumerismo el problema?

Saber pocas matemáticas nos convierte en ciudadanos más manipulables. El desconocimiento de los números carece del reproche social que provocan otras ignorancias. Una buena parte de las confusiones provienen de nuestra dificultad para manejar cifras muy grandes. La dificultad para manejar el concepto de números exponenciales también es un obstáculo para entender cómo funcionan las vacunas.

¿Cómo funciona la vacuna?

En mi experiencia como docente he observado que los alumnos no entienden como funcionan las vacunas y solo cuando se explican utilizando el crecimiento exponencial son capaces de entender la fortaleza de aumentar el número de linfocitos mediante la vacunación. Entender la vacunación solo se puede conseguir desde la comprensión del aumento exponencial 1 -> 2 -> 4-> 8 de linfocitos. 

El número de linfocitos suele estar por encima de 1500 células por microlitro de sangre (1,5 × 109 por litro) en los adultos. Si un adulto tiene 6 litros de media entonces 9 x 109 linfocitos. Existen tres tipos de linfocitos: Linfocitos B; Linfocitos T; Células NK. Para explicar cómo funciona una vacuna debemos simplificar. Hablaremos exclusivamente de linfocitos. La maduración de linfocitos, que se lleva a cabo de manera distinta para los linfocitos T y B la simplificaremos con el concepto "escuela de linfocitos". Simplificar significa obviar información no relevante para que lo que queremos subrayar resalte.

En esta explicación simplificada de cómo funcionan las vacunas haré hincapié en tres puntos críticos:

1/3 GENERACIÓN DE LINFOCITOS B CON UN ANTICUERPO DISTINTO CADA UNO DE ELLOS
2/3 ELIMINACIÓN DE LINFOCITOS QUE REACCIONEN CON EL PROPIO CUERPO
3/3 EXPANSIÓN CLONAL DEL LINFOCITO QUE SE UNA A LA PROTEÍNA DE LA VACUNA.

1/3 GENERACIÓN DE LINFOCITOS B CON UN ANTICUERPO DISTINTO CADA UNO DE ELLOS

Recombinación somática  o recombinación V(D)J permite que cada uno de los linfocitos que se generen de las células madre de la médula ósea exhiban en su superficie ig (inmunoglobulinas) también llamados anticuerpos. Cada linfocito va a exhibir un anticuerpo propio distinto de los demás.

La generación de variabilidad en los anticuerpos mediante recombinación somática o recombinación V(D)J es un proceso por el cual diferentes segmentos de ADN se mezclan al azar para formar un gen, de este modo se explica como unos pocos segmentos al combinarse de todas las maneras posibles produce anticuerpos diferentes. Fuente

2/3 ELIMINACIÓN DE LINFOCITOS QUE REACCIONEN CON EL PROPIO CUERPO

Durante la maduración, si los linfocitos B establecen interacciones con células y Ag (antígenos) propios, entonces se inicia la apoptosis. Este fenómeno de eliminación de células que no reconocen los Ag propios y el mantenimiento de las que sí lo hacen, se llama “selección positiva” . Esto es muy importante porque de ello depende que estos linfocitos no completen su maduración, de otra manera serían perjudiciales para el organismo, debido a que las células encargadas de las defensas no distinguen lo propio de lo extraño reaccionando de esta forma contra su propio cuerpo. Esto es el fundamento de las enfermedades autoinmunes.

Además de la apoptosis (como mecanismo de eliminación de células autoreactivas) existe otro proceso, la “edición del receptor”, que sería como una segunda oportunidad, porque aquí se induce una nueva recombinación VJ de la cadena ligera, lo que permite a la célula expresar una nueva Ig (inmunoglobulina) no reactiva, para continuar de este modo con su maduración.

3/3 EXPANSIÓN CLONAL DEL LINFOCITO QUE SE UNA A LA PROTEÍNA DE LA VACUNA.

El reconocimiento se lleva a cabo por la unión del Ag a una molécula de Ig de membrana (IgM o IgD) especifica, que son el receptor de los Linfocitos B. Si bien el receptor para el Ag son moléculas de IgM e IgD, estas no pueden enviar señales al interior de la célula, es por esto que junto a ellas se encuentran otro tipo de Ig llamadas Ig a e Ig b . Este complejo se denomina “Complejo receptor del
Linfocito B”:
En la imagen se aprecia la cascada de señales de activación que se disparan por la unión de las Igs del linfocito al Ag. Estas señales llevan al linfocito a dividirse de 1 -> 2 -> 4 -> 8 y así sucesivamente

 ANALOGÍAS PARA EXPLICAR CÓMO FUNCIONA UNA VACUNA

1/3 Generación de linfocitos B con un anticuerpo distinto para cada uno de ellos

A) En la médula ósea se generan los linfocitos. Todos los linfocitos son genéticamente idénticas porque, como el resto de las células del cuerpo humano, proceden del zigoto que se produjo por la fusión del óvulo materno y el esperma paterno. Sin embargo, cada uno de ellos tiene en su exterior un anticuerpo distinto. Los linfocitos tienen esa particularidad. Ese anticuerpo distinto le identifica. Mientras exista ese linfocito siempre tendrá ese tipo de anticuerpo particular en su superficie.

2/3 Eliminación de linfocitos que reaccionen con el propio cuerpo

B) Antes de que los linfocitos salgan al torrente sanguíneo tienen que pasar por la "Escuela de Linfocitos". Allí, se exponen en las paredes de esa escuela todas las moléculas que se expresan en el cuerpo humano. Si alguno de esos linfocitos se une a alguna de esas moléculas... el resultado es la muerte. Se le da una señal para que se suicide. ¿Por qué ocurre esto? C) Para que no salga al torrente sanguíneo ningún linfocito que pueda reaccionar contra nosotros mismos. Si este sistema no funciona bien tendremos enfermedades autoinmunes. Por eso TODOS los linfocitos son distintos entre ellos y no atacan el cuerpo humano. D) ¿Qué ocurre cuando inyectamos una vacuna? un fragmento del virus, por ejemplo la espícula que rodea al virus, va a circular por el torrente sanguíneo. Como es una parte del virus y no el virus entero pues no es infectivo ni causa ningún daño.

3/3 Expansión clonal del linfocito que se una a la proteína de la vacuna

E) Como hay millones de linfocitos distintos habrá alguno que reconozca el fragmento del virus. Cuando esto ocurre el linfocito que se ha unido al fragmento de virus (ver el subrayado amarillo) comienza a dividirse. De uno pasa a 2, esos dos se dividen en 4, los cuatro en 8, los ocho en 16... y así sucesivamente. Si un linfocito se divide 30 veces ¿Cuánta descendencia dejara? Es fácil calcularlo: 230

 = 1073 millones de linfocitos TOOOOODOOOS iguales, y todos con la capacidad de unirse al fragmento del virus.

F) ¿Qué es lo que hace que una persona vacunada no se muera?

Imaginemos dos personas, A y B. A está vacunado y B no. Si ambos se contagian al mismo tiempo, el virus circulará por la persona B dividiéndose y multiplicándose hasta que uno de los muchos linfocitos distintos que tiene B se una al virus. En ese momento el linfocito comienza a dividirse: 1 -> 2 -> 4 -> 8 ->16 -> 32 -> 64 -> 128 -> 256 -> 512 -> 1024 ¿Qué ocurre con A, el vacunado? que esa persona tiene 1073 millones que se dividen a 2941 millones y estos a 5883 millones y estos a 11767 millones...

Los linfocitos que tienen la capacidad de reconocer al virus pueden destruirlo, así que es más fácil destruir los virus con 11767 millones que con solo 8 linfocitos. 

PREGUNTAS POSTERIORES AL TALLER

PREGUNTA 4: La exposición a una vacuna contra un virus determinado, por ejemplo virus X, aumenta un tipo de linfocito B de 1 a 1000000 de linfocitos memoria con capacidad para reconocer a este virus X. Sin vacuna no existen linfocitos memoria contra este virus.

Dos amigos, Juan y Pedro. Juan es hijo de unos hippies antivacunas, Pedro ha sido vacunado. Ambos suben al Ecovía y se contagian con el virus. Se necesitan 100 millones de linfocitos para tener una respuesta eficaz para eliminar el virus.

Una vez que te infecta el virus X te mata al cabo de 48 horas. Los linfocitos B se dividen cada 2 horas. ¿Se salvarán los dos amigos? ¿Solo el vacunado?

TRANSFERENCIA DE APRENDIZAJE    

Con las siguientes preguntas evaluaremos si con otro ejemplo biológico el estudiante puede resolver el problema utilizando la expansión exponencial

PREGUNTA 5:  i) Tengo dos bacterias: A y B. La bacteria A tiene un cromosoma con 10.000 genes y se divide en dos bacterias cada 40 minutos. La bacteria B tiene 5000 genes. ¿Cuánto tiempo tarda B en dividirse?. ii) ¿Cuántas bacterias dejará de descendencia la bacteria A y cuántas la bacteria B tras 4 horas de crecimiento?

PREGUNTA 6: Clostridium difficile se divide cada 12 minutos. ¿Cuánto tiempo toma para que esta bacteria alcance 9,223372037×10¹⁸ descendientes?. Después de hacer este ejercicio ¿Podrías explicar la colitis pseudomembranosa? Si no es así mira la pregunta 15

PREGUNTA 7: En el problema del trigo y el ajedrez se muestra el poder de la progresión exponencial. Si nosotros incubamos una bacteria en presencia de antibiótico, como podemos ver abajo en el video, en la sección izquierda, la mayoría de las bacterias morirán en presencia de la penicilina. Si tenemos 9,223372037×10¹⁸ y se mueren el 99.99999% de las bacterias ¿Cuántas bacterias quedarían?

PREGUNTA 8: Comienzo un cultivo bacteriano a partir de 1 bacteria. Si se trata de Escherichia coli que se divide cada 20 minutos ¿Cuántas bacterias tendré a las 5 horas?

PREGUNTA 9: Si comienzo un cultivo 1 bacteria y al cabo de 6 horas tengo 16384 bacterias ¿Cuál será el tiempo medio de división de esta bacteria?

PREGUNTA 10: Después de un tratamiento antibiótico en el que han muerto el 99.99999% de las bacterias resulta que tengo 9,22x1011 bacterias. ¿Cuántas bacterias tenía en la infección antes de comenzar el tratamiento antibiótico?

PREGUNTA 11: i) Tengo dos bacterias: A y B. La bacteria A tiene un cromosoma con 15000 genes y se divide en dos bacterias cada 40 minutos. La bacteria B tiene 5000 genes. ¿Cuánto tiempo tarda B en dividirse?. ii) ¿Cuántas bacterias dejará de descendencia la bacteria A y cuántas la bacteria B tras 5 horas de crecimiento?

PREGUNTA 12: i) Tengo dos bacterias: A y B. La bacteria A tiene un cromosoma con 8000 genes y se divide en dos bacterias cada 40 minutos. La bacteria B tiene 5000 genes. ¿Cuánto tiempo tarda B en dividirse?. ii) ¿Cuántas bacterias dejará de descendencia la bacteria A y cuántas la bacteria B tras 3 horas de crecimiento?

PREGUNTA 13:
Cuando no existían bacterias toda la vida sobre la Tierra era vírica. Eran protovirus de ARN que tenían ribosomas. Estos virus se replicaban en la sopa biológica (en Ecuador en el locro biológico). Cuando aparecieron las bacterias, éstas tenían una membrana que diferenciaba fuera de dentro. Las bacterias metieron dentro todo lo que les interesaba de la sopa biológica. Los protovirus al quedarse sin su alimento sufrieron una presión selectiva que favoreció a aquellos virus que sabían como penetrar en el interior de las bacterias y alimentarse de lo que antaño había sido suyo. Nacieron los virus como entidades parásitas de las células. Muchos biólogos siguen diciendo, de forma equivocada, que los virus no son entidades vivas porque se tienen que alimentar de una célula metabólicamente activa. Si es por eso, podríamos incluir en la categoría de virus a muchas personas que no son capaces de subsistir sin su tarjeta de crédito. ¿Cómo perdieron los protovirus sus ribosomas? porque hoy en día los virus actuales no tienen ribosomas. Como siempre la solución está en la selección natural. Imaginemos dos virus A y B. El virus A es un protovirus, tiene ribosomas, y su ARN tiene 60.000 bases. El virus B perdió los genes de los ribosomas y por esa razón tienen 40.000 bases. No necesita codificar ribosomas porque puede utilizar los de la bacteria que infecta. Ambos virus infectan y se replican en el interior de bacterias. Si la ARN polimerasa copia a una velocidad de 1000 bases por minuto, y en los cromosomas de A y B existe un solo ORI. ¿Cuánto tiempo tarda cada virus en replicarse? ¿Cuánta descendencia tendrá cada virus al cabo de seis horas?

PREGUNTA 14: Tenemos dos virus A y B. El virus A tiene una tasa de letalidad del 0.1%, similar al de la gripe estacional. El virus B tiene una tasa de letalidad del 10%. En epidemiología el número reproductivo básico R0 es el número promedio de casos nuevos que genera un caso dado a lo largo de un período infeccioso.

La R0 de A y B es de 5 en ambos Si ambos virus infectan 1000 personas cada uno y esas personas vuelven a infectar otras personas y éstas a otras, es decir, tres ciclos de transmisión. Al final de esos dos ciclos de transmisión ¿Cuántas han muerto? ¿Cuántas desarrollaron anticuerpos?

PREGUNTA 15 Después de una hospitalización reciente o un tratamiento con antibióticos en el que la microbiota ha desaparecido, el colon de un paciente comienza su recolonización. Clostridium difficile, Escherichia coli y Lactobacillus spp tienen unos tiempos de generación de 12, 20 y 30 min respectivamente. Partimos de una bacteria de cada una de estas tres especies. ¿Cuántos descendientes tendrán después de 2 hr y 8 hr de crecimiento. ¿Cuál será el porcentaje sobre el total de bacterias de cada una de ellas? ¿Se entiende ahora la colitis pseudomembranosa?

Solución: 

PREGUNTA 16: Los habitantes de las islas del Pacífico se encuentran entre los más obesos del mundo. ¿Podrías explicar porqué utilizando la gráfica siguiente?
La gráfica tiene tres ejes. El eje X en negro es la línea de tiempo que avanza de izquierda a derecha. Los ejes Y son dos: el azul es número de individuos. Este eje crece de abajo arriba. El rojo es un poco más difícil de explicar. Sería variabilidad genética con respecto a una característica dada, por ejemplo, a la resistencia a los antibióticos. A medida que hay presión en el medio, en el tiempo se puede observar como se producen 5 cuellos de botella y como resultado de esto la población se va volviendo más resistente a los antibióticos, o si fuesen células cancerosas más resistentes a la quimioterapia. Sin que exista una variabilidad genética en donde la selección opere no puede haber evolución

El cuello de botella también se puede explicar con esta imagen:

PREGUNTA 17:  Una eyaculación humana produce de promedio unos 250 millones de espermatozoides. ¿Cuántos espermatozoides con la misma dotación cromosómica habría si no hubiese recombinación genética? Me explico con un ejemplo, imaginemos un espermatozoide que tenga los 23 cromosomas procedentes de la madre (es decir, de la abuela paterna del futuro bebé). Con esa dotación genética ¿Cuántos espermatozoides habría en 250 millones que tiene una eyaculación promedio?

Respuesta: probabilidad de que un espermatozoide tenga los 23 cromosomas procedentes de la madre es de 1 entre 223, es decir, 1 espermatozoide cada 8388608. Uno de cada 8 millones. En 250 millones de espermatozoides habrá 250/8 = 31 espermatozoides con dotación cromosómica procedente de la madre del progenitor

PREGUNTA 18: ¿Cómo podemos pasar del antibiograma de 2009 al de 2019?
PREGUNTA 19: Vamos a calcular el riesgo de entrar en la Unidad de Cuidados Intensivos si estás vacunado o si no estás vacunados tomando los datos de Asturias. Tenemos 870.807 personas vacunadas, el 85.48% de la población total. Si el 85.48% de las personas son 870.807, el 100% serán 1.018.726 personas, es decir, la población total.

Imaginemos que de 100 ingresados en la UCI, 80 son pacientes previamente vacunados y 20 son no vacunados

Solución: En Asturias los 870.807 personas vacunadas son el 85.48% de la población total y son el 93% si consideramos la población diana, esto es, la población mayor de 12 años.

Si 870.807 personas vacunadas son el 93% de la población diana. El 7% de las personas no vacunadas dentro de la población diana (>12 años) será

                                                870.807 ------ 93%

                                                    x   ---------100%,      X = 936.351 personas que viven en Asturias                                                                                                                       mayores de 12 años

El 7% de personas no vacunadas mayores de 12 será de 65544 personas

¿Cuántas personas vacunadas por cada 100.000 habitantes han visitado la UCI?

                                               870.807------- 80 personas

                                               100.000--------X,   X = 9,1 por cada 100.000 habitantes

¿Cuántas personas no vacunadas por cada 100.000 habitantes han visitado la UCI?

                                                65.544 ------- 20 personas

                                              100.000--------- X,      X = 30,5 por cada 100.0000 habitantes

Las personas no vacunadas en UCI son un 335% más que las vacunadas

PREGUNTA 20: ¿Podrías explicar la siguiente gráfica?
Los países que están arriba son irlanda y después Portugal. El país que está abajo es Bulgaria.

PREGUNTA 21: Imaginemos que te presentan los datos de la izquierda: de los pacientes ingresados en un hospital, un 33% son no vacunados y un 66% están vacunados. Por lo tanto, ¡Ojo esta conclusión es falsa! concluyes erróneamente que las vacunas no funcionan. Los datos de la derecha nos dicen que en la población general el 20% son no vacunados y el 80% son vacunados. ¿Cómo podrías convencer a un antivacunas de que las vacunas funcionan?

--------------------------------------------------------------------------------------------------------------------------

Para saber más: 

Vacunas y matemáticas salvan vidas I, Ignacio López-Goñi | #VacunasyMatemáticas

Linfocitos B. Cátedra de Bioquímica – Facultad de Medicina - UNNE

Cómo funcionan las vacunas de ARNm

Cómo funcionan las vacunas.  Portal Europeo de Información sobre Vacunación

¿Cómo actúan las vacunas? Organización Mundial de la Salud

Ejercicios sobre cálculo exponencial

Más ejercicios sobre los exponencial en biología

-------------------------------------------------------------------------------------------------------------------

Propuesta de examen: 5 preguntas multiopción

PREGUNTA 1: GENERACIÓN DE LINFOCITOS B CON UN ANTICUERPO DISTINTO CADA UNO DE ELLOS
PREGUNTA 2: ELIMINACIÓN DE LINFOCITOS QUE REACCIONEN CON EL PROPIO CUERPO
PREGUNTA 3 EXPANSIÓN CLONAL DEL LINFOCITO QUE SE UNA A LA PROTEÍNA DE LA VACUNA.
PREGUNTA 4: Se planteará un problema de crecimiento exponencial y se darán 5 posibles soluciones 
PREGUNTA 5: Se planteará un problema de crecimiento exponencial y se darán 5 posibles soluciones

La parasitología es la pariente pobre de la microbiología

En América Latina hay excelentes centros de investigación en parasitología: Instituto Clodomiro Picado, Instituto de Medicina Tropical "Dr. Félix Pifano"Fundación Oswaldo Cruz. La principal razón es que las parasitosis son importantes en nuestros países y no lo son tanto en aquellos países que invierten en ciencia y que pertenecen a países templados sin tanto impacto de estas enfermedades. Si nadie investiga para mitigar tus problemas no te queda más remedio que hacerlo tu mismo.

Fernando Mazariegos inventó el filtro de agua potable denominado «Ecofiltro» en 1990 para mitigar el impacto de parásitos y diarreas ¿En dónde? pues en aquellos países en donde gran parte de su población carecía de agua potable. ¿De dónde era este señor? ¿Alemania, Japón, EEUU? No, él era guatemalteco. 

La parasitología es como la rama pobre y subdesarrollada de la microbiología. Sin embargo, cuando vives en un país tropical te das cuenta del impacto y de su trascendencia. Por ese motivo, le he dedicado las siguientes entradas: 


Es el momento de escapar, de transmitirte a otro cuerpo

¿Se puede utilizar una ameba como un arma biológica?

10 razones para no minusvalorar la amebiasis

Protozoos intestinales

Calibración del microscopio

La matriuska genética en la enfermedad de la ceguera de los ríos

El parasitismo vive entre nosotros: lecciones de Toxoplasma

¿Qué es un parásito?

La historia de las enfermedades infecciosas es la de la arquitectura

¿Es importante seguir investigando en la enfermedad de Chagas?

Protozoos apicomplejos patógenos: Plasmodium, Toxoplasma y Cryptosporidium

Daniel Carrión, descubridor de la verruga peruana

Geohelmintos: gusanos parásitos transmitidos por el suelo

Gusanos planos: agarrarse para que no te arrastren

Verruga peruana: el sonido del silencio

Hongos patógenos